Article Figures & Data
Figures
- Fig. 1.
Phylogenic tree of the large Hop and Hor outer membrane protein family. Protein sequences were analyzed using the PHYLIP program. The two pairs of duplicated Hop proteins (HopJ/K and HopM/N) were not differentiated and are each visualized as one line.
- Fig. 2.
(A) Alignment of the C-terminal domains of the Y-Hop proteins from H. pylori J99 and 26695. The alignment is based on the sequence of HP0317, the strain-specific member fromH. pylori 26695. The proteins are listed as orthologous pairs from the two strains. Identical residues are indicated by colon; the eight predicted transmembrane sequences are indicated above the sequence. (B) BLOCKS alignment of the Hop and Hor proteins. BLOCKS is a method used to demonstrate similarity among a group of proteins that contain repeated sections of high similarity across the family (filled boxes) or a subset of the family (unfilled boxes) flanked by regions of lesser similarity (empty bars) and variable size (blank regions representing sequence missing from a given protein).
- Fig. 3.
Alignment of the variable domains of HopB (A) and HopC (B). The H. pylori 17874 proteins are found in GenBank (accession number Z82988) and are called AlpB and AlpA, respectively. Positions of the proteins included in the alignment are indicated with numbers; † indicates that the difference in position within the HopB protein represents a difference in the prediction of the initiation codon. The conserved cysteine residues in the HopB proteins are boxed. Identical (∗) and conserved (:) residues are indicated.
- Fig. 4.
Examination of H. pylori isolates for the duplication of hop genes. The genomic organization and primer binding location sites for JHP429 (hopJ) (A), JHP857 (hopK) (B), JHP212 (hopM) (C), and JHP1261 (hopN) (D) are shown. Representative PCRs are also shown in each panel, with the primer combinations used indicated. The loading order for each panel is as follows: marker (lane M), J99 (lane 1), 26695 (lane 2), ARHp64 (lane 3), SS1 (lane 4), UA861 (lane 5), ARHp12 (lane 6), ARHp18 (lane 7), ARHp25 (lane 8), ARHp210 (lane 9), ARHp65 (lane 10), ARHp55 (lane 11), ARHp124 (lane 12), ARHp54 (lane 13), CCUG17874 (lane 14), ARHp221 (lane 15), ARHp246 (lane 16), ARHp245 (lane 17), AH244 (lane 18), ARHp241 (lane 19), ARHp243 (lane 20), ARHp244 (lane 21), and no-DNA control (lane 22). The strains shown in the second gel in panel D (primers JHP1260 and hopMN-4) are indicated with the same numbering system. The sizes of the molecular weight markers are indicated.
- Fig. 5.
(A) Alignment of the JHP73 and the HP0078/HP0079 proteins. Amino acid positions of the proteins are indicated by numbers. Identical (∗) and conserved (:) residues are indicated. As predicted by Tomb et al. (61), the short HP0078 protein ends after 85 residues and the HP0079 protein begins 11 nt later. (B) PCR analysis of multiple H. pylori isolates for the presence of a JHP73 ortholog, using the primer combination jhp73F/jhp73R. Molecular weight markers are shown in lane M, with the sizes indicated on the left. The strains analyzed are J99 (lane 1), 26695 (lane 2), ARHp64 (lane 3), SS1 (lane 4), UA861 (lane 5), ARHp12 (lane 6), ARHp18 (lane 7), ARHp25 (lane 8), ARHp210 (lane 9), ARHp65 (lane 10), ARHp55 (lane 11), ARHp124 (lane 12), ARHp54 (lane 13), CCUG17874 (lane 14), ARHp221 (lane 15), ARHp245 (lane 16), AH244 (lane 17), ARHp243 (lane 18), and ARHp244 (lane 19).
Tables
- Table 1.
Comparison of OM proteins from H. pylori J99 (JHP) and 26695 (HP)
Protein group Gene no. Length (aa) % Size variation (aa) C-terminal residues % Identity Gene namea J99 26695 J99 26695 Protein Gene Family 1 (major outer membrane protein family) Hop proteins 7 0009 669b 672b 0.1 (1c) FAY 95.1 94.3 hopZ 21 0025 690 711 3 (21) FAY 85.2 85.8 hopD 212 0227 696 691 0.7 (5) FAY 81.6 83.7 hopM 214 0229 483 483 0 LAY 91.5 92.3 hopA 237 0252 479 487 1.6 (8) VGF 95.1 93.5 hopF 238 0253/0254 471 471e 0 IGF 98.1 96.8 hopG 429 0477 371 367 1.1 (4) YSF 88.1 88.9 hopJ 581 0638 307 305 0c NKH 92.8 94.5 hopH 645 0706 270 273 0f YTF 96.7 94.3 hopE 659 0722 638b 644b 1.2 (8c) FAY 87.8 90.9 hopO 662 0725 651b 653b 0.6 (4c) FAY 91.7 92.3 hopP 833 1243 744 733 1.5 (11) FAY 92.2 91.0 babA (hopS) 848 0912 520 515 1 (5) YSF 96.5 96.2 hopC 849 0913 527 529 0.4 (2) YAF 95.3 94.7 hopB 857 0923 366 369 0.8 (3) YSF 89.2 89.5 hopK 1083 1156 697 696 0.1 (1) IGF 95.4 95.1 hopI 1084 1157 1,237 1,230 0.6 (7) MGF 93.2 93.8 hopL 1164 0896 703 708 0.4 (3c) FAY 91.8 90.2 babB (hopT) 1103 1177 643 641 0.3 (2) FAY 87.6 89.3 hopQ 1261 1342 696 691 0.7 (5) FAY 81.6 83.7 hopN NAd 0317 NAd 745 NAd FAY NAd NAd hopU Hor proteins 73 0078/0079 255 684e 62.7 (429) IN(L/Fg) 94.1h 96.2h horA 117 0127 286 286 0 VSF 99.0 97.3 horB 307 0324 245 254 0f YHF 90.6 89.3 horC 359 1066 200 200 0 WHF 99.5 95.0 horD 424 0472 186 186 0 FTF 99.5 96.6 horE 614 0671 270 270 0 YNF 98.1 95.7 horF 732 0796 278 278 0 YDF 92.4 92.6 horG 1034 1107 220 230 0f YNF 91.7 90.8 horH 1040 1113 277 277 0 YSF 93.1 94.5 horI 1362 1469 248 248 0 RDF 94.8 94.6 horJ 1394 1501 388 388 0 YTF 97.9 95.6 horK 1432 1395 242 242 0 FTF 90.9 90.4 horL Family 2 (Hof family of outer membrane proteins) 195 0209 438 450 0f YRF 91.3 91.7 hofA 342 1083 479 479 0 AKF 95.6 93.8 hofB 438 0486 528 528 0 YSF 95.1 93.1 hofC 439 0487 465 480 0f RIY 95.4 92.1 hofD 719 0782 455 455 0 FFF 89.7 90.6 hofE 725 0788 499 499 0 WKL 97.2 95.2 hofF 850 0914 514 514 0 LKF 98.1 95.8 hofG 1094 1167 471 471 0 ASF 96.4 94.9 hofH Family 3 (Hom family of outer membrane proteins) 649 0710 657 660 0.5 (3) WVF 95.2 94.3 homA 870 NAd 668 NAd NAd WVF NAd NAd homB 1008 0373 751 700 6.8 (51) WVF 75.3 79.3 homC 1346 1453 744 746 0.3 (2) WIF 94.9 93.0 homD Family 4 (iron-regulated outer membrane proteins) FecA-like proteins 626 0686 767 767 0 YEF 93.1 92.6 fecA-1 743 0807 792 787 0.6 (5)i YNF 93.3 93.5 fecA-2 1426 1400 841 842 0f YTF 99.0 97.0 fecA-3 FrpB-like proteins 810 0876 791 791 0 YKW 97.6 94.9 frpB-1 851 0915/0916 815 812e 0.4 (3) YKF 96.2 93.7 frpB-2 1405 1512 879 877 0.2 (2) YQF 97.4 95.3 frpB-3 Family 5 (efflux pump outer membrane proteins) 552 0605 477 477 0 YVH 98.3 96.5 hefA 905 0971 431 413 0.4 (2f) VLH 92.3 91.2 hefD 1247 1327 412 412 0 GLE 93.7 93.4 hefG Other outer membrane proteins 456 0506 406 403 0.7 (3) EGF 96.6 93.9 600 0655 906 916 1.1 (10) TRF 96.4 94.7 634 0694 336 257 23.5 (79)j FAF 73.8 73.2 663 0726 305 305 0 FLF 93.4 92.8 1022 0358 511 511 0 GLF 93.3 93.2 1360 1467 231 231 0 YKF 95.2 93.2 308 0325 237 237 0 MPY 98.3 96.8 flgH 777 0839 587 587 0 YRW 97.8 94.3 1054 1125 179 179 0 LVK 95.5 96.3 palA 1349 1456 175 175 0 VKK 100 96.6 lpp20 ↵a Those with Hop-like motifs have been named hop genes, with the original hopA-E gene names being assigned to those previous identified (17, 22). Proteins related to the hop family but lacking the N-terminal motif have been called hor (hop related) genes. The family of 50-kDa outer membrane protein genes has been calledhof (Helicobacter OMP family) genes. The smaller family of outer membrane protein genes has been called hom(Helicobacter outer membrane) genes.
↵b Out of frame due to a CT dinucleotide repeat in the signal sequence. Protein size was determined by adjusting the coding sequence by the addition or removal of a single dinucleotide repeat.
↵c The size variation does not include the differences caused by the different numbers of CT dinucleotide repeats in the coding sequence.
↵d NA, not applicable.
↵e The HP0253 and HP0254 genes, the HP0078 and HP0079 genes, and the HP0915 and HP0916 genes were joined by the addition or removal of a single nucleotide.
↵f Size difference due to difference in prediction of initiation codons between H. pylori J99 and 26695.
↵g Protein terminates with an F residue in 26695 and an L in J99.
↵h The identity was calculated over the aligned portion of the proteins only.
↵i There is significant difference in the C-terminal 20 amino acids. The C terminus of JHP743 is found in a different reading frame in H. pylori 26695 and likely represents a frameshift in HP0807.
↵j The remainder of JHP634 is found in a different reading frame in H. pylori 26695 after a frameshift.
- Table 2.
Strains used in this study
Strain Country Isolation yr Disease state Reference J99 United States 1994 Duodenal ulcer 4 26695 United Kingdom 1986a Gastritis 20 AH244 Sweden 1993 Duodenal ulcer This study SS1 Australia 1995a Dyspepsia 37 UA861 Canada 1991 Duodenal ulcer 54 ARHp210 Sweden 1997 Asymptomatic This study ARHp12 United States 1993a Natural rhesus monkey isolate This study ARHp18 Canada 1989a —b This study ARHp25 Australia 1989a — 33 ARHp64 Argentina 1996a Nonulcer dyspepsia This study ARHp65 Argentina 1996a Nonulcer dyspepsia This study ARHp55 United States 1996a Duodenal ulcer This study ARHp124 Bangladesh 1996a Hiatus hernia and gastritis This study ARHp54 United States 1996a Duodenal ulcer This study CCUG 17874c Australia 1984 — 41 ARHp221 United States 1998 Cat isolate 26 ARHp246 Kuala Lumpur 1998 Duodenal ulcer, gastritis This study ARHp245 France 1998 Pernicious anemia This study ARHp241 Kuala Lumpur 1998 Duodenal ulcer, erosive gastritis This study ARHp243 France 1998 Duodenal ulcer This study ARHp244 France 1998 Nonulcer dyspepsia This study - Table 3.
Primers used in this study
Name Sequence (5′-3′) hopJK GAAGAAAATGGGGCGTATGCGAGCG jhp430 TCCAACAGAAAGAGCGTTTGAAGGC jhp858 GCCAGAAAATGGAGGGCCAACAAACG jhp428 CGGCTCAAATCCGTGTCTTCAATGCG jhp856 TGCGGGCATAGGGGCTAGGTTTGGGC jhp213 ATCACAGAAAGCCCCACCACAAAACC jhp211 TCGCGCTAGGGACGACAATCTCCC jhp1260 GGCTTTAGAAGCCATTAAAAGCGCGG jhp1262 TATTTGTATGCGGGTATTGGTTTTGC hopMN-1 GAAGATGACGGATTTTACATGAGTGTGGG hopMN-2 GCGCTAAAGCCACAGCTTGATAGGCC hopMN-3 TGAAAACACCCAAATCACGCAACC hopMN-4 TTGGATAGGCCCTTGAATGCTGTGG hopMN-5 TGAACGGCATCGGCGTGCAAGCGGGC jhp73F GAAAAAAGCGGCGCGTTTTTAGGAGGG jhp73R GAACACATCTACCGATCCATCTACGCC jhp73R2 CCCCCAACACAACAAAATAAATATCGC
