Molecular Pathogenesis

Decreased Infectivity in Borrelia burgdorferi Strain B31 Is Associated with Loss of Linear Plasmid 25 or 28-1

Maria Labandeira-Rey, Jonathan T. Skare
DOI: 10.1128/IAI.69.1.446-455.2001

Article Figures & Data

Figures

  • Fig. 1.
    Fig. 1.

    Plasmid profiles of B. burgdorferi strain B31 clones MSK5, ML28, ML23, ML28, and MSK10. PCR analysis was performed as detailed in Materials and Methods with oligonucleotide primers listed in Table 2. PCR products were resolved by electrophoresis on a 1.5% agarose gel. Molecular size markers (in base pairs) are indicated on the left. The asterisk in the MSK7 panel indicates the location of a putative primer dimer observed with the lp28-4 oligonucleotide primers.

  • Fig. 2.
    Fig. 2.

    Plasmid profile of the polyclonal B. burgdorferi strain B31 passage 48 (P48) sample. PCR analysis was performed as detailed in Materials and Methods using the primers shown in Table 2. PCR products were resolved by electrophoresis in a 1.5% agarose gel. Molecular size markers (in base pairs) are indicated on the left.

  • Fig. 3.
    Fig. 3.

    Dot blot analysis of B. burgdorferi strain B31 clones. Fifty nanograms of total plasmid DNA from each clone was blotted onto a nylon membrane and hybridized with probes specific to the plasmids indicated above the lanes. The clones tested are listed vertically on the left (see Table 1 for details). The plasmid tested and the probe from each plasmid are specified as follows (TIGR designations are used): cp9, region including bbc10(rev paralogue); lp25, bbe16; lp28-1, a 1.7-kb region including bbf30, bbf31, and part of the bbf32 cassette region described previously (32); lp28-4, bbi16 (vraA); and lp54, bba16 (ospB).

Tables

  • Table 1.

    B. burgdorferi strain B31 genotypic variants used in this study

    B31 variant(s)DescriptionSource or reference
    MSK5Clone obtained from the skin of a mouse infected with low passageB. burgdorferi B31 and determined to have all of the known plasmidsThis study
    MSK7Clone obtained from the skin of a mouse infected with low-passage B. burgdorferi B31 and determined to be lp28-4−This study
    MSK10Clone obtained from the skin of a mouse infected with low-passage B. burgdorferi B31 and determined to be lp28-1−This study
    P48B. burgdorferi B31 isolate originally obtained from a mouse infected with low-passage B. burgdorferi B31 and serially passaged in vitro 48 times6
    ML28Clone isolated from nonclonal P48 sample and determined to be cp9− and lp28-1−This study
    ML23Clone isolated from nonclonal P48 sample and determined to be lp25−This study
    MJ1 to -20Clones from tibiotarsal joint tissue of mice infected with clone ML28 passage 2This study
    OMB1 to -20Clones isolated from bladder tissue of mice infected with nonclonal P48 sampleThis study
    OMS1 to -20Clones isolated from skin tissue of mice infected with nonclonal P48 sampleThis study
    OMJ1 to -99Clones isolated from tibiotarsal joint tissue of mice infected with nonclonal P48 sampleThis study
  • Table 2.

    Oligonucleotides used in this study

    PlasmidGenome designationSequence (5′ to 3′)Predicted fragment size (bp)
    cp9BBC10FGAACTATTTATAATAAAAAGGAGAGC459
    BBC10RATCTTCTTCAAGATATTTTATTATAC
    BBC07FGATGAAAATCTTTCACAAAAG291
    BBC07RAACAATAATAGAGATAAAGGG
    cp26BBB19FAATAATTCAGGGAAAGATGGG573
    BBB19RAGGTTTTTTTGGACTTTCTGCC
    lp5BBTFCTTGCTTTAAGCCCTATTTCAC645
    BBTRGCACACTACCCATTTTTGAATC
    lp17BBD10FCAAACTTATCAAATAGCTTATC519
    BBD10RACTGCCACCAAGTAATTTAAC
    lp25BBE16FATGGGTAAAATATTATTTTTTGGG618
    BBE16RAAGATTGTATTTTGGCAAAAAATTTTC
    lp28-1BBF20FATGAACAAAAAATTTTCTATTTC291
    BBF20RGTTGCTTTTGCAATATGAATAGG
    BBFFCGCTGGACAGTTTATATTGGGG1,723
    BBFRGTTGATAATGCTAATGCTGGGGAC
    lp28-2BBG02FTCCCTAGTTCTAGTATCTACTAGACCG810
    BBG02RTTTTTTTTGTATGCCAATTGTATAATG
    lp28-3BBH06FGATGTTAGTAGATTAAATCAG651
    BBH06RTAATAAAGTTTGCTTAATAGC
    lp28-4BBI16FCAGGCCGGATTTTAATATCGA1,300
    BBI16RGTTTATATTTTGACACTATAAG
    BBI16(II)FGCAGGCCGGATTTTAATATCGATC732
    BBI16(II)RGCTCATTAGATAGCGTATTTTTTAG
    lp36BBK19FAAGTTTATGTTTATTATTGC316 (610)a
    BBK19RATTGTTAGGTTTTTCTTTTCC
    lp38BBJ34FAAATTCTATGGAAGTGATG1,010
    BBJ34RTTTCTATTTATTTTTAGGC
    lp54BBA16FGCACAAAAAGGTGCTGAG840
    BBA16RTTTTAAAGCGTTTTTAAGC
    lp56BBQ56FAAGATTGATGCAACTGGTAAAG975
    BBQ56RCTGACTGTAACTGATGTATCC

    • ↵a BBK19F anneals to both strands, yielding a 316-bp amplimer; see text for details.

  • Table 3.

    Genotypic compositions of ML clones derived from a nonclonal P48 isolate

    Plasmid(s) absent No. of clones (%) (n = 49)
    cp9, lp25, lp28-1, lp28-413a (26.5)
    cp9, lp25, lp28-426b (53.1)
    cp9, lp28-1, lp28-41 (2.0)
    cp9, lp254c (8.2)
    cp9, lp28-42 (4.1)
    cp9, lp28-11d (2.0)
    lp25, lp28-41 (2.0)
    lp28-41 (2.0)

    • ↵a Two clones had a low PCR signal for lp25, five clones had a low PCR signal for lp28-1, and one clone had a low PCR signal for lp28-4.

    • ↵b Three clones had a low PCR signal for lp25, and two clones had a low PCR signal for cp9.

    • ↵c Two clones had a low PCR signal for cp9.

    • ↵d The clone had a low PCR signal for lp28-1.

  • Table 4.

    ID50 determination for B. burgdorferi strain B31 clones

    Isolate and inoculumNo. of cultures positive/total no.No. of mice positive/total no. of miceCalculated ID50
    SpleenJointHeartBladderSkinLymph nodeAll sitesSpleenJointHeartBladderSkinLymph node
    MSK5a1.8 × 1021.8 × 1021.8 × 1021.8 × 1021.8 × 1021.8 × 102
     1053/33/33/33/33/33/318/183/3
     1043/33/33/33/33/33/318/183/3
     1033/33/33/33/33/33/318/183/3
     1021/31/31/31/31/31/36/181/3
     1010/30/30/30/30/30/30/180/3
    MSK7b1.9 × 1033.2 × 1035.6 × 1021.9 × 1031.9 × 1031.9 × 103
     1053/33/33/33/33/33/318/183/3
     1043/32/33/33/33/33/318/183/3
     1031/31/32/31/31/31/37/182/3
     1020/30/30/30/30/30/30/180/3
     1010/30/30/30/30/30/30/180/3
    MSK10b>105 1043.4 × 104 105 105>105
     1050/31/30/30/30/30/31/181/3
     1040/33/30/31/31/30/35/183/3
     1030/31/32/30/30/30/33/182/3
     1020/30/30/30/30/30/30/180/3
     1010/30/30/30/30/30/30/180/3
    ML28c>1053.2 × 103>105>105>105>105
     1050/33/30/30/30/30/33/183/3
     1040/31/30/30/30/30/31/181/3
     1030/32/30/30/30/30/32/182/3
     1020/30/30/30/30/30/30/180/3
     1010/30/30/30/30/30/30/180/3
    ML23c>105>105>105>105>105>105
     1050/30/30/30/30/30/30/180/3
     1040/30/30/30/30/30/30/180/3
     1030/30/30/30/30/30/30/180/3
     1020/30/30/30/30/30/30/180/3
     1010/30/30/30/30/30/30/180/3

    • ↵a Wild type (refers to a clone not derived from nonclonal P48 that has been determined to have all of the known plasmids).

    • ↵b Both of these clones were isolated from the skin from a mouse infected with low-passage B. burgdorferistrain B31.

    • ↵c Both of these clones were derived from nonclonal P48.

  • Table 5.

    ID50 determination for nonclonal P48 B. burgdorferi strain B31

    InoculumNo. of cultures positive/total no.No. positive mice/total no. of miceCalculated ID50
    SpleenJointHeartBladderSkinAll sitesSkinOther sites
    1053/33/33/33/32/314/153/36.8 × 1021.6 × 102
    1043/33/33/33/32/314/153/3
    1033/33/33/33/33/315/153/3
    1020/30/30/30/30/30/150/3
    1010/30/30/30/30/30/150/3
  • Table 6.

    Comparison of genotypic compositions of B. burgdorferi strain B31 P48 clones following either in vitro cultivation or in vivo selection in C3H/HeN mice

    PlasmiddPresenceain P48
    In vitrob (n = 49)cIn vivo
    +−Skin (OMS)e(n = 20)Bladder (OMB)e (n = 20)Joint (OMJ)e (n = 99)Total (n = 139)
    +−+−+−+−
    cp94.1 (2)95.9 (47)0 (0)f100 (20)0 (0)f100 (20)1 (1)i99 (98)0.7 (1)99.3 (138)
    lp2510.2 (5)89.8 (44)100 (20)g0 (0)100 (20)g0 (0)100 (99)g0 (0)100 (139)0 (0)
    lp28-169.4 (34)30.6 (15)85 (17)g15 (3)100 (20)g0 (0)75.7 (75)i24.3 (24)80.6 (112)19.4 (27)
    lp28-410.2 (5)89.8 (44)0 (0)h100 (20)10 (2)h90 (18)4 (3)f96 (96)3.6 (5)96.4 (134)

    • ↵a The values indicate the percentage of samples that contained the given plasmid (+) versus the percentage that lacked the given plasmid (−). Actual numbers of samples are indicated parenthetically.

    • ↵b Reflects the eight different genotypic variants shown in Table 3.

    • ↵c Number of individual colonies (clones) tested.

    • ↵d Plasmids lost either individually or as a group in the genotypic variants shown in Table 3.

    • ↵e See Table 1.

    • ↵f χ2 analysis indicates a selection (P < 0.05) against this plasmid when this tissue is compared to the in vitro sample.

    • ↵g χ2 analysis indicates a significant selection (P < 0.001) for this plasmid when this tissue is compared to the in vitro sample.

    • ↵h χ2 analysis indicates a significant selection (P < 0.001) against this plasmid when this tissue is compared to the in vitro sample.

    • ↵i χ2 analysis indicates no significant selection for or against this plasmid when this tissue is compared to the in vitro sample.

Back to top
Download PDF
Citation Tools
Print

Alerts
Email

KEYWORDS

Borrelia burgdorferi Group
plasmids

Related Articles

Cited By...