Article Figures & Data
Figures
- Fig. 1.
(A) Schematic of the sar promoters and transcripts analyzed in this study. Positions of the transcription start sites (146, 409, and 711 bp upstream of the translation start) for P1, P3, and P2 promoters are depicted according to published sequence (2). The P1, P3, and P2 transcripts have previously been designated a sarA, sarC, andsarB transcripts. The 49-bp sequence outlined was used to construct a DNA-specific column as described elsewhere (27). Relative positions of the sar promoter fragments used in gel shift and footprinting studies are indicated (filled boxes); the promoter fragments for the GFP transcriptional fusion assays are represented by empty boxes. (B) Promoter region ofsarR. The transcription start site has been mapped by primer extension (data not shown) to position 119. The putative −10 and −35 promoter boxes are in bold and underlined. (C) Alignment of SarR with SarA. Colons represent identity; periods indicate conservative substitutions.
- Fig. 2.
Purification of SarR from the pET11b expression vector. Equivalent volumes of protein fractions obtained during the purification process were applied to an SDS–12% polyacrylamide gel. Lane 1, whole-cell lysate of E. coli containing pALC1357 (pET11b with the sarR gene); lane 2, supernatant of the cell lysate after clarification by centrifugation; lane 3, supernatant before 40% ammonium sulfate precipitation; lane 4, pellet resulting from 40% ammonium sulfate precipitation; lane 5, pellet from 80% ammonium sulfate precipitation; lane 6, flowthrough of the redissolved 80% ammonium sulfate precipitant as applied to a MonoQ column (Pharmacia); lane 7, flowthrough from the MonoS column (Pharmacia); lane 8, NaCl elution from the MonoS column. N-terminal sequencing confirmed the identity of the purified SarR protein.
- Fig. 3.
PCR amplification of sarR-like genes in S. aureus strains RN6390, Cowan I, DB, and Newman, S. epidermidis, S. haemolyticus, and S. saprophyticus using primers 5′-208ATGAGTAAAATTAATGATATTAAT231-3′ and 5′-589TCGTTCAATGTTATTAAACG569-3′. (B) Southern blot of the above strains, restricted withClaI and probed with a 345-bp sarR probe (nt 208 to 552). (C) Northern blot of total cellular RNA (10 μg each) of the above strains, probed with a sarR probe. (D) Cell lysates of the above strains, immunoblotted onto nitrocellulose and probed with anti-SarR monoclonal antibody 2A7 at a 1:2,000 dilution.
- Fig. 4.
Gel shift assay of end-labeled 32P fragment of sar P1 (nt 531 to 859) 2, P2 (nt 1 to 196), and P3 (nt 364 to 525) promoters. Increasing amounts (30, 60, 100, 150, 200, 250, and 300 ng) of purified SarR were applied to the reaction mixtures. In competition assays, 50- and 100-fold excesses of unlabeled DNA fragments were added.
- Fig. 5.
DNase I footprinting assays of SarR with end-labeled32P sar P2 (49-bp fragment), P1 (nt 531 to 859), and P1′ (nt 620 to 859) promoter fragments. The sequence was deduced from G+A ladder reactions run in parallel by the standard method (26). The following amounts of SarR were applied to thesar P2 and P1 reactions: 30, 60, and 100 ng. Withsar P1′, only lanes containing 30 and 60 ng of SarR protein are shown. The binding site of SarR on the sar P3 promoter (underlined) was also mapped: 373TTACTAAATTAAAAAAATTA402(footprinting data not shown) (2). The underlined nucleotides represent the 7- or 8-base sequence conserved in the binding site throughout the sar promoter region.
- Fig. 6.
Expression of sarR in parental strain RN6390 and its sar (ALC488) and agr (RN6911) mutants. (A) Northern blots of sarR transcript in RN6390 and its isogenic sar and agr mutants. Ten micrograms of total cellular RNA was applied to each lane. The sarR probe was a 345-bp fragment (nt 208 to 552). OD650 of 0.7, 1.1, and 1.7 represent mid-log, late log, and early stationary phases, respectively, as predicted from the growth cycle. (B) Ethidium bromide stain of the above RNA gel prior to transfer to a hybridization membrane. (C) Expression of SarR on an immunoblot probed with anti-SarR antibody 2C7. Each lane contains 25 μg of cell extract of RN6390 grown to late log and early stationary phases. Cells at mid-log phase expressed little SarR; as expected, SarR was not detected in thesarR mutant ALC1713 (data not shown). The positive control lane contains 0.1 μg of purified SarR protein.
- Fig. 7.
Promoter activation of sar P1 and combined P2-P3-P1 promoters fused to a gfpuvr reporter gene as evaluated in a fluorescence spectrophotometer (FL600; BioTek Instruments). (A) Recombinant shuttle plasmid pALC1484 containing thesar P1 promoter linked to gfpuvr (excitation maxima at 488 nm) was introduced into strain RN6390 (♦) and its isogenic sarR mutant ALC1713 (•). A negative control (RN6390 containing pALC1484 with no promoter fragment) showed no significant background fluorescence (background = ∼300 fluorescence units [data not shown]). Cells were obtained hourly (200 μl of each in duplicate) during the growth cycle (from h 2 to 10 after an initial dilution of 1:100 in fresh medium) to obtain fluorescence and OD values in the same instrument. To minimize variations in fluorescence attributable to cell density, the data are presented as average of reported fluorescence per OD unit in triplicate samples plotted against the mean OD. The error bar was too small to be discerned (typically less than 100 fluorescence units). The experiment was repeated at least thrice; one representative experiment is shown. (B) Plot similar to that in panel A except that the combinedsar P2-P3-P1 promoter fragment was used in place of the P1 promoter in the recombinant pALC1484 containing thegfpuvr reporter gene. In similar assays with the individual sar P2 and P3 promoters linked to thegfpuvr reporter in the isogenic pair, we detected no differences in GFPuvr expression between the parental strain and the sarR mutant. However, the level of fluorescence associated with individual P2 and P3 promoters was very low and only slightly above background levels.
- Fig. 8.
Effect of the sarR mutation on SarA andagr expression. (A) SarA expression during mid-log, late log, and early stationary phases; (B) agrA (RNAII) transcription. (A) Immunoblot of cell extracts (5 μg of protein each) of RN6390 and the sarR mutant (harvested at mid-log, late log, and stationary phases) probed with anti-SarA monoclonal antibody 1D1 at 1:2,000 dilution. The positive control lane contains 0.5 μg of purified SarA. Similar results were obtained with 25 μg of protein per lane. (B) Northern blot of the RNAII (agrA probe) transcript in RN6390 and the sarR mutant (10 μg of total RNA each). The agrA probe corresponds to nt 3830 to 4342 according to the published sequence 23.
Tables
- Table 1.
Strains and plasmids used
Strain or plasmid Reference or source Comments S. aureus RN4220 32 Mutant of 8325–4 that accepts foreign DNA RN6390 32 Laboratory strain that maintains its hemolytic pattern when propagated on sheep erythrocyte agar (parental strain) RN6911 34 agr mutant of RN6390 with Δagr::tetM mutation ALC488 9 sar mutant with sarA::ermCmutation ALC1713 This study sarR mutant of RN6390 with ΔsarR::ermC mutation Cowan I 17 Laboratory strain DB 10 Clinical blood isolate previously used in adhesion and endocarditis studies Newman 29 Laboratory strain S. epidermidis Strain from collection at Utrecht University Hospital S. haemolyticus Strain from collection at Utrecht University Hospital S. saprophyticus Strain from collection at Utrecht University Hospital E. coli XL-1 Blue 26 Host strain for cloning DH5α 26 Host strain for cloning Plasmids pCR2.1 Invitrogen E. coli cloning vector for direct cloning of PCR products pBluescript Stratagene E. coli cloning vector pUC18 26 E. coli cloning vector pACYC177 New England Biolabs E. coli cloning vector pCL52.1 24 Temperature-sensitive E. coli-S. aureus shuttle vector pET11b Novagen Expression vector for E. coli pALC926 This study pUC18 containing a 49-bp fragment upstream of the P2 promoter of the sar locus pALC1357 This study pET11b containing the 345-bp sarR gene at theNdeI/BamHI site pALC1361 This study pACYC177 with a ∼4-kb ClaI fragment containing thesarR region of RN6390 pALC1627 This study pBluescript with a 2.5-kb EcoRI/ClaI fragment containing the sarR gene subcloned from pALC1361 pALC1687 This study pBluescript with a 290-bp deletion of the sarR gene in pALC1627 pALC1696 This study pCL52.1 with a 290-bp sarR deletion replaced by theermC gene at the EcoRV/SalI site
