Article Figures & Data
Figures
- Fig. 1.
(A) Effect of H2O2 (7.5 mM) on washed, exponential-phase CLR-grown cells of 8325-4 (wild type) (▪), MJH001 (perR) (○), and ST16 (katA) (▴) and 8325-4 (wild type) grown in CLR with 20 μM manganese chloride (■). (B) Catalase activity gel. (C) Total catalase activity of washed, lysed, stationary-phase cells after 24 h of growth in CLR medium (open bars), CLR with 20 μM manganese chloride (gray bars), or CLR with 20 μM iron sulfate (black bars).
- Fig. 2.
Growth of 8325-4 (wild-type) (▪), MJH001 (perR) (▵,) and ST16 (katA) (○) strains in CL with no added metal ions except magnesium (A), CL with 20 μM iron sulfate (B), CLR (C), and CL with 20 μM manganese chloride (D). All cultures were inoculated at an OD600 of 0.002.
- Fig. 3.
Alignment of the putative PerR boxes identified in the incomplete S. aureus genome databases. Boxes were identified as described previously (37). An S. aureus consensus sequence was compiled from all of the sequences identified and compared to the B. subtilisconsensus (19).
- Fig. 4.
(A) Mapping of the 5′ end of the perR,katA, mrgA, ahpC, andfur mRNA by primer extension. RNA was isolated from exponential cultures of 8325-4 (wild type) grown in CLR (OD600 of 1.0), and 100 μg of RNA was used for each reaction. The potential transcription start sites are marked with arrows. Lanes G, T, A, and C show the dideoxy sequencing ladder obtained with the same primer used for primer extension (x). (B) Sequence of the identified promoter regions. Potential −35 and −10 regions and transcriptional start sites are underlined. PerR boxes are in boldface.
- Fig. 5.
Analysis of transcription from promoter-lacZ fusions during growth in CLR medium. 8325-4 (wild type) containing the fusion indicated was grown in CLR medium (▴), CLR with 20 μM manganese (⋄), and CLR with 20 μM iron sulfate (○). Transcription of the lacZ fusions in MJH001 (perR) (▪) is shown on each graph. Samples were removed at the times indicated and sampled for β-galactosidase activity. The strains grew with slightly different growth rates as indicated in Fig. 2, but for reasons of clarity only the changes in β-galactosidase activity are shown. The lacZfusions shown are MJH002 (ahpC-lacZ), MJH003 (bcp-lacZ), MJH004 (ftn-lacZ), MJH005 (fur-lacZ), MJH006 (katA-lacZ), MJH007 (mrgA-lacZ), MJH008 (perR-lacZ), and MJH009 (trxB-lacZ), and these same fusions in theperR mutant background are MJH102, MJH103, MJH104, MJH105, MJH106, MJH107, MJH108, and MJH109, respectively.
- Fig. 6.
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of total proteins from wild-type and MJH001 (perR) strains after growth to stationary phase in CLR at 37°C. The AhpC, Ftn, and MrgA proteins identified by N-terminal sequencing are shown.
- Fig. 7.
Starvation survival of 8325-4 (wild type) (■), MJH001 (perR) (▴), and ST16 (katA) (●) after growth and incubation in CDM containing 0.1% (wt/vol) glucose (glucose limiting). Samples were aseptically removed at the times indicated, and viability was assessed by dilution and counting on BHI agar.
- Fig. 8.
Pathogenicity of S. aureus strains in a murine skin abscess model of infection. Approximately 108CFU of each strain was inoculated subcutaneously into 6- to 8-week-old BALB/c mice; the strains used were 8325-4 (wild type) (n = 10), MJH001 (perR) (n = 10), and ST16 (katA) (n = 16). Seven days after infection, mice were euthanized, lesions were removed and homogenized, and viable bacteria were counted after dilution and growth on BHI agar plates. The mean percent recovery of each strain and the Studentt test P values are as follows, respectively: 8325-4 (wild type), 143%; MJH001 (perR), 10.5% and P < 0.005; and ST16 (katA), 86.3% and P = 0.124.
Tables
- Table 1.
Strains, plasmids, and primers used in this study
Strain, plasmid, or primer Genotype, description, or sequencea Reference or source Strains E. coli DH5α φ80 Δ(lacZ)M15 Δ(argF-lac)U169 endA1 recA1 hsdR17 (rK−mK+) deoR thi-1 supE44 gyrA96 relA1 56 S. aureus 8325-4 Wild-type strain cured of prophages Lab stock RN4220 Restriction-deficient transformation recipient Lab stock MJH001 perR::kan This study MJH002 ahpC::pAZ106ahpC+ This study MJH003 bcp::pAZ106bcp+ This study MJH004 ftn::pAZ106ftn+ This study MJH005 fur::pAZ106fur+ This study MJH006 katA::pAZ106katA+ This study MJH007 mrgA::pAZ106mrgA+ This study MJH008 perR::pAZ106perR+ This study MJH009 trxB::pAZ106trxB+ This study ST16 katA::Tn917-LTV1 This study SPW1 sodA::Tn917-LTV1 65 MJH102 perR::kan ahpC::pAZ106 ahpC+ This study MJH103 perR::kan bcp::pAZ106 bcp+ This study MJH104 perR::kan ftn::pAZ106 ftn+ This study MJH105 perR::kan fur::pAZ106 fur+ This study MJH106 perR::kan katA::pAZ106 katA+ This study MJH107 perR::kan mrgA::pAZ106 mrgA+ This study MJH108 perR::kan perR::pAZ106 This study MJH109 perR::kan trxB::pAZ106 trxB+ This study MJH408 perR::kan pMAL34 (perR+) This study MJH418 8325-4 pMAL34 (perR+) This study Plasmids pAZ106 Promoterless lacZ erminsertion vector 16 pGem3Zf(+) General cloning vector Promega pAUL-A Temperature-sensitiveerm integrational shuttle vector 15 pCU1 E. coli-S. aureus cat shuttle vector 7 pMAL5 pGem3Zf(+) containing a 2-kb perR fragment with engineered ClaI site This study pMAL7 pMAL5 containing a kancassette in ClaI site. This study pMAL8 3.5-kbBamHI-HindIIIperR::kan fragment from pMAL7 in pAUL-A This study pMAL9 1.08-kb OL7–OL11 perRpromoter-containing fragment in pAZ106 This study pMAL10 0.6-kb OL13–OL14 fur promoter-contaiing fragment in pAZ106 This study pMAL11 1.2-kb OL15–OL16katA promoter-containing fragment in pAZ106 This study pMAL12 1.2-kb OL17–OL18 ahpCF promoter-containing fragment in pAZ106 This study pMAL13 1.1-kb OL19–OL20mrgA promoter-containing fragment in pAZ106 This study pMAL28 0.6-kb OL53–OL54 bcp promoter-containing fragment in pAZ106 This study pMAL29 1.4-kb OL60–OL61ftn promoter-containing fragment in pAZ106 This study pMAL30 1.4-kb OL62–OL63 trxB promoter-containing fragment in pAZ106 This study pMAL34 0.9-kb OL82–OL83perR gene-containing fragment in pCU1 This study Primers OL7 AATTGGATCCCATGGTTTGCAACGGGTG This study OL8 CCGGAAGCTTATCCTGAGCCAGGATCAAACTCTCCAT This study OL9 GAATCAATTGCATCGATTGCGACAAGCAGGCG This study OL10 CGCCTCCTTGTCGCAATCGATGCAATTGATTC This study OL11 CCAGAATTCGAATCGACTTGATGAGTCTCCATATG This study OL12 AATTGGATCCTGTAATGGTTTGCCACTTTGCAG This study OL13 CCAGAATTCAGTAGCTTCGCGTTGTGGCGTTAGC This study OL14 AATTGGATCCATTACCAAACGGTGAAACGTC This study OL15 CCAGAATTCAACGCAGCTTGTTCAACATCC This study OL16 AATTGGATCCGACCACAATGCCCAATACAACC This study OL17 CCAGAATTCTGAATGTACCACGTTGAGCTAAC This study OL18 AATTGGATCCATGGTAAGCGTGGCTTGGCTGC This study OL19 CCAGAATTCTACATCATCGCCAGCATTACC This study OL20 AATTGGATCCATGGCAATTTCGTGTCGCGAGG This study OL53 GGTTGGATCCAATTTCTAATTCAGTCGGTGTACC This study OL54 CCAGAATTCTAAATTGTCTCTAAAGTCACAAGC This study OL60 AGAAGGATCCGCGTTATAAGCGTTAAAGTCAC This study OL61 AGCAGAATTCTGCATGTGCACCTCTGTCG This study OL62 AGAAGGATCCAGAACTGATTACGATTGGTAG This study OL63 AGCAGAATTCCTGCCAAATACTTTCCGTCATC This study OL82 AGAGGATCCACAGCGCATATAACTGGTAATG This study OL83 CCAGAATTCCTTATACTCACTTTATGGATAG This study PEX2 AGCTCCATGGTCTGACGCTCAGTGGAACGAAAACTC This study PEX3 CAGTAGCTTCGCGTTGTGGCGTTAGC This study PEX4 GGTGTAATTCTTACGCCTGCTTGTCGC This study PEX5 TCTCGGTCTGATACTGGATGCC This study PEX6 TTACAACATCTTGTTGATTACTC This study Tn1 GGAACGCCGTCTACTTACAAGCAGC This study Tn2 CTCACAATAGAGAGATGTCACCGTC This study ↵a In primer sequences, the restriction sites are underlined.
