Induction of Cell-Mediated Immunity againstMycobacterium tuberculosis Using DNA Vaccines Encoding Cytotoxic and Helper T-Cell Epitopes of the 38-Kilodalton Protein

Mice.Inbred C57BL/6 (H-2^b) female mice were purchased from the Central Animal Laboratory of Utrecht University and used when 8 to 12 weeks old. The Ethics Committee on Animal Experimentation of Utrecht University approved these experiments.

Antigens and synthetic peptides.The 38-kDa recombinant protein was purified to homogeneity as described previously (29). Tuberculin purified protein derivate (PPD) was obtained from Statens Serum Institute (Copenhagen Denmark). Peptides derived from the sequence of the 38-kDa protein were synthesized by R. van der Zee at the Peptide Center of the Research School of Infection and Immunity (Veterinary Faculty, Utrecht) or by D. L. Jue at the Core Facility of the Centers for Disease Control and Prevention (Atlanta, Ga.). The peptide amino acid sequences were as follows: P1 (amino acids [aa] 97 to 108), AGTVNIGASDAY(H-2D^b); P3 (aa 166 to 175), IAALNPGVNL(H-2D^b); P4 (aa 309 to 318), YPIINYEYAI(H-2D^b); and Th (aa 70 to 84), PAFHERYPNVTITAQ (potential H-2D^b motif, but anchor residues N and I not in the ideal position).

Genetic constructs.pXJ38, a plasmid in which the gene coding the 38-kDa protein of M. tuberculosis was cloned into the expression vector pcDNA3, was a gift from X. Zhu and H. M. Vordermeier (VLA-Weybridge, TB Research Group, Surrey, United Kingdom) (39).

Two vectors were used for constructing the plasmids containing the various epitopes: pcDNA3.1+ and VR1012. Both vectors consist of a pUC18 backbone with the same cytomegalovirus (CMV) promoter. They differ in the kanamycin versus the ampicillin selection markers and in the polyadenylation site. In vivo and in vitro experiments revealed no differences between the two vectors in CTL induction, cytokine production (IFN-γ), or B-cell activation (polyclonal immunoglobulin M [IgM] production) in mouse spleen cells.

Three plasmids based on Th and CTL epitopes of the 38-kDa protein ofM. tuberculosis were constructed. The nucleotide sequence corresponding to the epitopes was generated by using two overlapping oligonucleotides that served as both a primer and a template. All of the forward primers included a restriction site; a Kozak sequence (GCCGCCGCC), which enhances protein expression (18); the ATG start codon; and a part of the nucleotide sequence of the epitope. All of the reverse primers included a part of the nucleotide sequence of the epitope, the TAG stop codon, and a restriction site. Primers for the construction of pP3, encoding the previously described P3 CTL epitope (aa 166 to 175) (7), were as follows (nucleotide sequence corresponding to the epitope in boldface): sense, ATCCGGATCCGCCGCCGCCATGATCGCTGCGTCAACCCC; antisense, GGATCTCGAGCTACAGGTTCACGCCGGGGTTGAGCG. This construct was inserted into BamHI and XhoI sites of the eukaryotic expression vector pcDNA3.1+ (Invitrogen, San Diego, Calif.) downstream of the CMV promoter. The primers for the construction of vTh, encoding part of the previously described Th epitope (aa 71 to 81) (36), were as follows: sense, ATCCGTCGACGCCGCCGCCATGGCCTTTCACGAGAGG; antisense, GGATGGATCCCTAGATCGTGACGTTCGGATACCTCTCGTGA. This construct was inserted into SalI andBamHI sites of the eukaryotic expression vector VR1012 (Vical, Inc., San Diego, Calif.) downstream of the CMV promoter.

For the construction of pThP3, which contained the nucleotide sequences corresponding to the Th and CTL epitopes, the inserts encoding both epitopes were generated separately and then ligated into pcDNA3.1+. The Th insert was generated with the following primers: sense, ATCCGGATCCGCCGCCGCCATGGCCTTTCACGAGAG; antisense, GGATGAATTCGATCGTGACGTTCGGATACCTCTCG. The primers for the P3 insert were as follows: sense, ATCCGAATTCATCGCTGCGCTCAACCCCG; antisense, GGATCTCGAGCTACAGGTTCACGCCGGGGT. Th was inserted into BamHI and EcoRI sites of the pcDNA3.1+ vector, while P3 was inserted between EcoRI andXhoI sites, downstream of the CMV promoter. All plasmids were cloned into Escherichia coli DH5α, and the positive colonies were selected by PCR or restriction enzyme analysis. The nucleotide sequences of the inserts in all plasmids were confirmed by sequencing with the ABI Prism 377 (Perkin-Elmer, Norwalk, Conn.). The pcDNA3.1+ and VR1012 vectors, which do not encode any of the inserts, were used as controls (control vectors). Plasmid DNA was amplified inE. coli DH5α, purified with the Qiagen plasmid purification kit (Qiagen, Inc., Chatsworth, Calif.), redissolved in phosphate-buffered saline (PBS), and maintained at −20°C until use.

Cell lines and culture medium.EL-4 (H-2^b), a thymoma cell line, was a gift from P. van Koten (Department of Immunology, Veterinary Faculty, Utrecht University, The Netherlands); and EX-38 (H-2^b), an EL-4 cell line transfected with the gene encoding an M. tuberculosis 38-kDa protein, was a gift from X. Zhu and H. M. Vordermeier (VLA-Weybridge, TB Research Group, Surrey, United Kingdom) (39). All cells were grown in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% heat-inactivated fetal calf serum, 10 μg of gentamicin per ml, 2 mM glutamine, 1.7 g of NaHCO₃, and 50 μM β-mercaptoethanol (IMDM-complete). The transfected cell line, EX-38, was grown in IMDM-complete with G418 at a concentration of 1 mg/ml.

Immunization procedures.Mice were injected three times biweekly with 100 μg of the plasmid DNA, pXJ38, vTh, pP3, pThP3, or a mixture of vTh and pP3 (vTh+pP3) (50 μg of vTh plus 50 μg of pP3) or with control DNA vectors (PcDNA3.1+ or VR1012) in the quadriceps muscle. Blood samples were collected from the retroorbital plexus, and spleens were isolated 2 weeks after the last injection.

In vitro expansion of antigen-specific CTL.After spleen isolation, cell suspensions were prepared as described previously (38), and the erythrocytes were lysed by hypotonic shock and washed twice with IMDM. Spleen cells (30 × 10⁶) from in vivo-primed mice were cocultured with mitomycin (Sigma Chemical Co., St. Louis, Mo.)-treated EX-38 cells (1.5 × 10⁶) in a 10-ml cell suspension in IMDM-complete for 5 to 6 days at 37°C in 5% CO₂. Ten to 30 U of recombinant interleukin-2 (IL-2) per ml (Roche Diagnostics, Mannheim, Germany) was added after 48 h of culture.

⁵¹Cr release assay.Cells were collected from the in vitro culture and washed once with IMDM-complete. Viable cytotoxic effector cells were separated from dead cells by centrifugation with a Lympholyte-M density gradient (820 ×g for 10 min), washed twice, and resuspended in RPMI 1640 supplemented with 5% fetal calf serum (CTL medium) at a concentration of 4 × 10⁶ cells/ml. EX-38 or EL-4 target cells (2 × 10⁶) were incubated for 1 h at 37°C with 100 μCi of ⁵¹Cr (Amersham, Life Science, United Kingdom). After being washed three times, 5 × 10³ target cells/100 μl were added to 100 μl of various numbers of effector cells that had been plated in 96-well U-bottom plates. The plates were then centrifuged for 1 to 2 min at 200 × g and incubated for 4 to 6 h at 37°C in 5% CO₂. After incubation, 100 μl of supernatant was collected and counted in a gamma counter. The specific lysis (percentage of cytotoxicity) was calculated with the equation % Lysis = [(sample − spontaneous release)/(total release − spontaneous release)] × 100%.

In the antibody-blocking experiments, either anti-mouse CD4 monoclonal antibody (MAb) (clone GK1.5) or anti-mouse CD8 MAb (clone 53–6.7) (Pharmingen, San Diego, Calif.) was added (5 μg/well) to the effector cells 30 min before the ⁵¹Cr-labeled EX-38 cells were added (39).

In vitro cytokine production and cytokine determination by ELISA.Pools of spleen cell suspensions (5 × 10⁶ cells) from groups of mice immunized with DNA constructs (PxJ38, ThP3, Th, and Th+P3 or plasmid alone) were cultured in IMDM-complete in 24-well plates in the presence of 20 μg of PPD per ml, 20 μg of recombinant 38-kDa protein per ml, or 50 μg of 38-kDa peptides (P1, P3, P4, and Th) per ml at 37°C in 5% CO₂. Supernates were harvested after 72 h, aliquoted, and stored at −20°C until assayed for specific cytokines. IL-4 and IFN-γ contents were measured with a commercial enzyme-linked immunosorbent assay (ELISA) kit (Genzyme Co, Cambridge, Mass.) according to the manufacturer's protocol. Results are expressed as mean cytokine level of duplicate wells after subtracting the spontaneous release of the cytokine by unstimulated cells.

Detection of IgG1 and IgG2a by ELISA.Recombinant 38-kDa protein was dissolved in 0.1 M carbonate-bicarbonate buffer (pH 9.6), while peptide P3 or Th was dissolved in PBS at a concentration of 10 μg/ml. Both were then dispensed into 96-well polyvinyl microtiter plates (100 μl/well) (MaxiSorp F96; Nunc, Roskilde, Denmark). Plates coated with the 38-kDa protein were incubated for 1 h at 37°C, followed by overnight incubation at 4°C; plates coated with peptide P3 or Th were incubated overnight at 37°C. Free binding sites were blocked with 3% gelatin (Merck) in PBS for 1 h at 37°C. Serial dilutions of sera were prepared in PBS–0.05% Tween 20 1% (wt/vol) milk (Protifar), dispensed into ELISA plates, and incubated for 2 h at 37°C. After incubation, the plates were washed three times with PBS–0.05% Tween 20. Then, 50 μl of either biotin-conjugated mouse anti-mouse IgG2a (Igh-1b) or biotin-conjugated mouse anti-mouse IgG1 (Igh-4b) (Pharmingen) in PBS–0.05% Tween 20 3% (wt/vol) milk (Protifar) was added. After a 1-h incubation at 37°C, the plates were washed again three times and incubated with 50 μl of horseradish peroxidase-conjugated streptavidin for 15 min at 37°C. After a final washing, 50 μl of substrate (0.1 M NaAc–tetramethyl benzidine–30% H₂O₂ at 10,000:400:1 [vol/vol/vol]) was added. The reaction was stopped after 20 to 30 min with 100 μl of 1 M H₂SO₄, and the plates were read in a Titertek Multiskan MCC/340 at 450 nm. The titers were defined as the reciprocal dilution that gave an optical density of 0.5 at 450 nm.

Statistical analysis.Differences between the ability of the plasmid DNA vaccines to induce CTL were analyzed with Student'st test. P < 0.05 was considered to be significant.