Construction and Evaluation of a Safe, Live, Oral Vibrio cholerae Vaccine Candidate, IEM108

V. cholerae O1 strains.The bacterial strains used in this study are listed in Table 1. IEM101 (16), a live cholera vaccine candidate strain of the El Tor biotype, is naturally CTXΦ negative but has toxin-coregulated pilus (TCP) pili. Classical strains O395 (Ogawa) and 1119 (Inaba), as well as El Tor strains Wujiang-2 (Inaba) and Bin-43 (Ogawa), were used as the challenge strains in challenge and protection studies with rabbit models. All V. cholerae strains were propagated in Luria-Bertani (LB) broth or on gentamicin agar (GTA; peptone [10 g/liter], beef extract [3.0 g/liter], NaCl [5.0 g/liter], sucrose [10.0 g/liter], sodium citrate [10.0 g/liter], sodium sulfite [3.0 g/liter], agar [15 g/liter], gentamicin [500 μg/liter], polymyxin B [3,000 μg/liter]; pH 8.4 ± 0.1).

IEM101-T is a thymidine-auxotrophic strain derived from IEM101. It was previously constructed in our laboratory and has the central one-third of the thymidylate synthase gene (thyA) deleted from its genome. IEM101-T can grow in LB broth only with the addition of thymidine (50 μg/ml). However, when IEM101-T was transformed with the plasmid pXXB106 (30) (Table 2) carrying the Escherichia coli-derived thyA to complement its chromosomal thyA deletion, the transformed bacteria could be grown in LB broth without thymidine. This thyA-based chromosome-plasmid lethal balanced system was used to construct IEM108 by introducing plasmid pUTBL3 (Table 2) into IEM101-T.

E. coli strains used in molecular cloning and conjugation.The E. coli strains used in this study are listed in Table 1. PL101 (30), a spontaneous E. coli DH5α thyA mutant, was used as the recipient of plasmid pUTBL3 containing ctxB, rstR, E. coli-derived thyA, and truncated bla. PL101 was grown in CBT medium (M9 minimal medium containing 0.5% glucose, 0.5% casein hydrolysate, and 0.1 μg of VitB/ml) supplemented with trimethoprim (15 μg/ml) and thymidine (50 μg/ml). For conjugation, SM10λpir (25) was used as the recipient strain of recombinant suicide plasmids pKRSn and pKRSe (Table 2). The E. coli strain JM109 was used for transformation in general molecular cloning.

Genetic constructs.The plasmid constructs involved in genetic cloning and conjugation are listed in Table 2.

Construction of the candidate IEM108.The 1.15-kb XbaI fragment containing the upstream regulatory and coding regions of ctxB was recovered from pBR (a pUC19-derived plasmid carrying ctxB and rstR, constructed in our laboratory before) and cloned into the XbaI site of pXXB106, containing E. coli-derived thyA (30), resulting in two new constructs, pUTBL1-5 and pUTB1-6. ctxB and thyA have the same transcriptional direction in pUTBL1-5 and opposite directions in pUTBL1-6 (Fig. 1).

• Open in new tab
• Download powerpoint

FIG. 1.

Linear diagrams of plasmid constructs. Open boxes, gene segments; arrows, gene orientations; solid box, RS2 region, including rstR, rstA, and rstB genes from V. cholerae O1 El Tor strain in plasmid pKRSe or from a classical strain in pKRSn; arrowheads, PvuI sites.

The rstR gene and its upstream sequence were amplified from El Tor strain Bin-43 with primers PrstR1 (CCGAATTCACTCACCTTGTATTCG) and PrstR2 (CGGAATTCTCGACATCAAATGGCATG). The amplified fragment was then cloned into the EcoRI site of pUTBL1-5, yielding new construct pUTBL2. Subsequently, an 0.8-kb PvuI fragment of the bla gene in pUTBL2 was deleted to generate pUTBL3. pUTBL3 was then electroporated into IEM101-T to construct IEM108.

Conjugation.Plasmid pCT5A11 (8) contains a 15-kb HindIII fragment of El Tor strain 1621 including the CTX^ETΦ genome and its flanking sequence. After digestion with PstI, the plasmid was blunt ended with T4 DNA polymerase and further digested with SacI. The 3.6-kb fragment containing the RS2 sequence was gel purified and ligated into the suicide vector pKTN701 (pKTN701 was digested with XbaI, blunt ended with the Klenow fragment of DNA polymerase I, and then digested with SacI) to generate plasmid pKRSe, which contains RS derived from the CTX^ETΦ genome. Plasmid pKRSn is also pKTN701 based and contains the RS sequence derived from the CTX^classΦ genome that was constructed in our previous work. These two recombinant suicide plasmids were used as a model to evaluate CTXΦ immunity.

SM10 carrying pKRSe or pKRSn was used as the donor strain to mate with IEM108 and IEM101, respectively. Mating mixtures were plated on the 0.22-μm-pore-size filter membrane stuck on the surface of LB agar and then cultured at 37°C for 6 h. The bacteria were washed and diluted with phosphate-buffered saline (PBS) and then plated on GTA selective media supplemented with 15 μg of chloramphenicol/ml to enumerate the number of transconjugants and on GTA without chloramphenicol to determine the total number of recipient strains. Transconjugant frequency is calculated as the ratio of transconjugants among recipients, as determined from the ratio of CFU of Cm^r Get^r colonies to CFU of Get^r colonies.

GM1-ELISA.A GM1-enzyme-linked immunosorbent assay (GM1-ELISA) was used to determine the expression of CTB in pUTBL1-5 and pUTB1-6 and anti-CTB titers in sera of immunized rabbits. A 96-well plate was coated with 2 μg of GM1(Sigma)/ml (100 μl/well) overnight at 4°C. Wells were washed three times with PBS plus 0.05% Tween 20 (PBT) and blocked with 1% bovine serum albumin (300 μl/well) in PBS for 1 h at 37°C. One hundred microliters of supernatant of JM109 cell lysate transformed with pUTBL1-5 and pUTB1-6 was added to each well, and the plate was incubated at 37°C for 1 h and washed again with PBT. The plate was then incubated with 100 μl of a 1:2,000 dilution of a polyclonal rabbit anti-CT antiserum/well for 1 h at 37°C, washed with PBT, and incubated for 1 h at 37°C with 100 μl of a 1:1,000 dilution of horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG). The plate was subsequently washed with PBT. HRP-bound antibodies were visualized by adding o-phenylenediamine (Sigma) as the substrate. After 15 to 30 min the reaction was blocked by the addition of H₂SO₄ at a final concentration of 1 M and the absorption was read at 492 nm. Positive results were determined if the ratio of the sample to the control was ≥2. For the control we added supernatant of JM109 cell lysate.

The titer of the serum anti-CTB IgG antibody for the immunized rabbits was measured by GM1-ELISA as described above. Briefly, each well was coated with 100 μl of GM1 (2 μg/ml), saturated, and washed. Then 100 μl of CT (1 μg/ml) was added to each well, and the plates were incubated for 1 h at 37°C and washed again. The 1:5-diluted test sera (100 μl) were added to 100 μl of PBS in the first wells and then doubly diluted serially to 1:10,240. Plates were incubated and washed, and HRP-conjugated goat anti-rabbit IgG was added as described above. The preimmune sera were used as the negative control, and a 1:2,000 dilution of a polyclonal rabbit anti-CT antiserum was used as the positive control. The reciprocal titer is defined as the highest dilution of serum that gave an A₄₉₂ ratio of sample to negative of ≥2.0.

Serum vibriocidal antibody assay.Serum vibriocidal antibody titers were measured in a microassay using 96-well plates. The immunized rabbit sera were inactivated at 56°C for 30 min and diluted 1:5 with PBS before use. The prediluted rabbit sera were added into the first well and then serially diluted threefold in PBS. PBS was added to the last well as a negative control. The plates were incubated for 30 min at 37°C with 25 μl of a solution containing 10² CFU of V. cholerae Bin-43/ml of culture and 20% guinea pig serum as a complement source in PBS. One hundred fifty microliters of 0.01% 2,3,5-trihenyltetrazolium chloride in LB broth was added to each well, and the plates were further incubated for 4 to 6 h at 37°C until the negative-control wells showed a color change. The reciprocal vibriocidal titer is defined as the highest dilution of serum that completely inhibits growth of Bin-43, i.e., no color change.

Rabbit immunization.Eight adult New Zealand White rabbits (2 to 2.5 kg) were divided into naive, IEM101, and IEM108 groups. The naive group consisted of two rabbits that were not immunized. Each immunization group had three rabbits. After fasting for 24 h, the rabbits in both immunization groups were anesthetized with ether. After the abdominal skin was sterilized with an iodine tincture and alcohol, the abdominal cavity was opened by vertical incision (under sterile conditions). General exploration was performed to find the ileocecal region. This region was ligated to the inner wall of the abdomen. Then 10⁹ CFU of vaccine strain IEM101 or IEM108 were injected into the proximal ileum. Finally, the abdominal cavity was closed. The ligature that tied the ileocecal region to the abdominal wall was removed 2 h later, and the rabbits were given water and feed for 28 days. One rabbit of the IEM101 group died after the operation, probably because of heavy anesthesia. Serum samples were collected from the immunized rabbits prior to the immunization and on days 6, 10, 14, 21, and 28 after the vaccination. The serum titers for the anti-CT antibody and vibriocidal antibody were measured as described above.

Rabbit ileal loop assay and protection model.To evaluate the protection efficacy in vivo, the immunized rabbits were challenged with pure CT and four virulent V. cholerae strains (395, 119, Wujiang-2, and Bin-43) of different serotypes and biotypes (Table 1) 28 days after the single-dose immunization. Rabbits were anesthetized and their abdomens were opened as described above. Their intestines were tied into 4- to 5-cm-long loops, and then 10⁵ to 10⁸ CFU of challenge strains or 1, 2, 3, or 4 μg of pure CT was injected into each loop. Normal saline was used as negative control. At 16 to 18 h postchallenge, the rabbits were sacrificed and the accumulated fluid from each loop was collected and measured. The ratio of the volume of accumulated fluid (milliliters) to the length of the loop (centimeters) was calculated for each loop in the challenged rabbits.

Construction of IEM108 based on the thyA plasmid-chromosome lethal balanced system.In our previous work, we destroyed the thyA gene of IEM101 by deleting the central one-third of the gene, thus obtaining the thymidine-auxotrophic V. cholerae strain, IEM101-T. That study (30) showed that E. coli-derived thyA can complement the thyA function of V. cholerae and that plasmid pXXB106 containing E. coli-derived thyA can stably be maintained in a spontaneous V. cholerae ΔthyA mutant. When transformed with the plasmid pXXB106, IEM101-T grew well in LB medium. Therefore, we cloned the ctxB gene into pXXB106. To test if this cloned ctxB affects the expression of thyA because of its highly efficient promoter, plasmids pUTBL1-5 and pUTBL1-6, which have different insertion directions of ctxB, were electroporated into IEM101-T. We then assessed V. cholerae growth on LB media without thymidine. Comparisons of in vitro growth kinetics of IEM101 and IEM101-T (containing pUTBL1-5 and pUTBL1-6, respectively) showed a significantly reduced growth rate and an extended log phase for IEM101-T containing pUTBL1-6, whereas IEM101-T containing pUTBL1-5 and IEM101 had similar growth rates (Fig. 2). This observation may indicate that the reverse insertion of ctxB in pUTBL1-6 influenced the expression of thyA and therefore was responsible for the reduced levels of growth. Based on the different growth rates, we chose pUTBL1-5 for the cloning of rstR.

• Open in new tab
• Download powerpoint

FIG. 2.

Comparison of the growth curves of IEM101, IEM101-T containing pUTBL1-5, and IEM101-T containing pUTBL1-6. Single clones of IEM101, IEM101-T containing pUTBL1-5, or pUTBL1-6 were grown in LB broth at 37°C to exponential phase, and the optical density at 600 nm (OD₆₀₀) of each culture was adjusted to 0.3. Then 300 μl of each was inoculated into 30 ml of fresh LB broth in 100-ml flasks and grown aerobically at 37°C. The OD₆₀₀ of each culture was detected at different times during growth.

The fragment containing the rstR gene and its upstream sequence of the El Tor strain Bin-43 was amplified and cloned into the EcoRI site of pUTBL1-5 to generate pUTBL2. Thus, the cloned rstR gene is derived from the El Tor-derived CTX^ETΦ genome. In accordance with the proviso that an antibiotic resistance gene cannot appear in a recombinant plasmid which is introduced into the vaccine candidate, the bla in pUTBL2 was deactivated by deleting a 0.8-kb PvuI fragment to generate pUTBL3. Therefore, pUTBL3 contains ctxB, rstR, E. coli-derived thyA, and the truncated bla gene. pUTBL3 was electroporated into IEM101-T to construct IEM108. pUTBL3 was maintained in IEM108 grown on LB agar plates without the need for antibiotic selection pressure.

The immunity of IEM108 against phage CTX^ETΦ infection and the ability to regain toxicity.Our previous studies have shown that the recombinant suicide plasmid containing RS2 could integrate into the chromosome of IEM101. In addition, this recombinant plasmid could replicate in its plasmid form (10). To test the ability of IEM108 to resist CTXΦ infection from both classical and El Tor sources and to test the cross-immunity induced by rstR against CTXΦ derived from different biotypes, the two SM10 donor strains, one containing pKRSn and one containing pKRSe, were used as a conjugation model. pKRSn contains the classical biotype-derived RS2 region, while pKRSe contains the El Tor-derived RS2 region. The average conjugation frequencies between recipient strains and donor strains are shown in Table 3. There was a 100-fold reduction in frequency of conjugation to the El Tor-derived RS2 region in IEM108 compared with the corresponding frequency for IEM101. However, when IEM101 and IEM108 mated with donor strain SM10 (containing pKRSn), the reduction of conjugation frequency for IEM108 was about ninefold less than that for IEM101 (Table 3).

The immunogenicity of IEM108 in (immunized) rabbits.Antibody analysis results for immunized rabbits showed that none of the rabbits produced anti-CTB antibodies and vibriocidal antibodies in their preimmune serum. After immunization, specific anti-CTB antibodies were detected in rabbit sera immunized with IEM108. They became detectable on day 10 after vaccination, and peak titer (1:4,155, on average) and plateau were reached on day 21 (Fig. 3). No anti-CTB antibody was detected in IEM101-immunized-rabbit sera. The vibriocidal antibody responses in sera from rabbits immunized with IEM101 and IEM108 were found to be very similar (Fig. 4). They became detectable on day 6 postimmunization and reached their peak on day 14. However, we found that the antibody titer for the IEM108 group is not only much higher than that for the IEM101 group but also decreases more slowly and thus lasts a longer time.

• Open in new tab
• Download powerpoint

FIG. 3.

Average titers of serum anti-CTB IgG antibodies after immunization with IEM101 and IEM108.

• Open in new tab
• Download powerpoint

FIG. 4.

Average titers of serum vibriocidal antibodies after immunization with IEM101 and IEM108.

Protection against the challenges of toxigenic V. cholerae in vaccinated rabbits.Fluid accumulations of different rabbit groups are shown in Fig. 5 and 6. In the naive-animal group, all the loops had significant amounts of fluid accumulation after being challenged with either CT or bacteria. Furthermore, the higher the challenge dose, the more fluid was accumulated. In the group of IEM101-vaccinated animals, no significant fluid accumulation was detected in the loops subjected to a lower dose (10⁵ to 10⁷ CFU) of the bacterial challenge. However, when the challenge dose increased to 10⁸ CFU, the loops in rabbits challenged with the classical strain 1119 and the El Tor strain Wujiang-2 had average levels of fluid accumulation of 0.35 and 0.86 ml/cm of loop, respectively. All loops challenged with different doses of CT had very significant amounts of fluid accumulation: about 0.32, 0.53, 0.87, and 0.84 ml per cm of intestinal loop for 1, 2, 3, and 4 μg of CT, respectively. We detected no fluid accumulation in the group of IEM108-immunized rabbits after the challenge with either CT or bacteria, which indicates that IEM108 elicits more-effective antibacterial immunity than IEM101 and furthermore induces an antitoxic response.

• Open in new tab
• Download powerpoint

FIG. 5.

Average fluid accumulations in the rabbit ileal loops after challenge with pure CT.

• Open in new tab
• Download powerpoint

FIG. 6.

Average fluid accumulations in the rabbit ileal loops after challenge with the strains O395, 1119, Wujiang-2, and Bin-43. Different animal groups are indicated as follows: naive, gray bars; IEM101, white bars; IEM108, black bars.