Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Infection and Immunity
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Molecular Pathogenesis

Analysis of Expression Profile of Mammalian Cell Entry (mce) Operons of Mycobacterium tuberculosis

Ashwani Kumar, Mridula Bose, Vani Brahmachari
Ashwani Kumar
1Dr. B. R. Ambedkar Center for Biomedical Research
2Department of Microbiology, Vallabh Bhai Patel Chest Institute, Delhi University, Delhi-110007, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mridula Bose
2Department of Microbiology, Vallabh Bhai Patel Chest Institute, Delhi University, Delhi-110007, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Vani Brahmachari
1Dr. B. R. Ambedkar Center for Biomedical Research
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: v_brahmachari@hotmail.com
DOI: 10.1128/IAI.71.10.6083-6087.2003
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Analysis of the expression of mce1 genes. (A) Schematic representation of the mce operons. The arrowheads indicate the position of the junction primers (J1 to J5). (B) Amplicons of RT-PCR with junction primers. Primer sets used are indicated above each lane. M, 100-bp ladder as a size marker; -ve, negative control, where mce1 primers were used in a PCR without an RT step. The RNA concentration was 300 ng per 20 μl of reaction mixture. The fast-moving band has the primer dimers.

  • FIG. 2.
    • Open in new tab
    • Download powerpoint
    FIG. 2.

    Analysis of expression profile of mce operons in exponential phase. Amplicons of RT-PCR with specific primers for mce1, mce2, mce3, and mce4 and RNA from 10-day-old cultures as the template were analyzed by electrophoresis; the operon-specific primers used are indicated above the lanes. M, 100-bp ladder. Equal concentrations of RNA (500 ng per 20 μl of reaction mixture) were used in all experiments; rpoB was used as a positive control. The fast-moving band has the primer dimers.

  • FIG. 3.
    • Open in new tab
    • Download powerpoint
    FIG. 3.

    Analysis of expression profile of mce operons in stationary phase. Amplicons of RT-PCR with operon-specific primers as indicated above each lane were analyzed; rpoB was used as a positive control. M, 100-bp ladder. The RNA from 20-day-old cultures was used at a concentration of 500 ng per 20 μl of reaction mixture. The fast-moving band has the primer dimers.

  • FIG. 4.
    • Open in new tab
    • Download powerpoint
    FIG. 4.

    Analysis of expression profile of mce operons in bacilli from spleens of infected guinea pigs (A) and from pulmonary tubercles from infected rabbits (B). The amplicons are from RT-PCR with operon-specific primers as indicated above each lane; rpoB-specific primers were used as a positive control. M, 100-bp ladder; -ve, negative control, where the RT step was omitted for rpoB-specific primers to rule out DNA contamination. The RNA concentration was 300 ng per 20 μl of reaction mixture in each case. The fast-moving band has the primer dimers.

  • FIG. 5.
    • Open in new tab
    • Download powerpoint
    FIG. 5.

    Analysis of expression profile at exponential growth phase (A) and stationary growth phase (B), analyzed by RT-PCR with gene-specific primers for 10 genes reported to be expressed in infected macrophages. The gene amplified is indicated above each lane. M, 100-bp marker. The RNA concentration was 300 ng per 20 μl of reaction mixture in each case. mce1 was used as a positive control (A). The fast-moving band has the primer dimers.

  • FIG. 6.
    • Open in new tab
    • Download powerpoint
    FIG. 6.

    Schematic representation of the organization of mce2 and mce1, -3, and -4. Each open rectangle indicates a gene within the operon. Hatched rectangle, Rv0590A; filled rectangle, Rv0586 (encoding a putative lactate dehydrogenase regulator); arrow, putative start site of transcription of the first gene of the mce operon.

Tables

  • Figures
  • TABLE 1.

    Sequences of primers used in analysis of expression profile of mce operons and genes expressed during infection (5)

    Gene or operonForward primerReverse primer
    mce2 CGACATGGCTTTCACCTCTG CCGACCCCACATCAATCAC
    mce3 CAACACCCGCGAGATTCAG GTTCTTCGAATGCAGTACC
    mce4 CACCTTCCTCATCCCCTC GATGAGCGATTGGAACAAC
    sigE CAATATCACGACCATCACGACCTT AGCACCACCGCGGCACGAAACT
    sigH GGCCTGGCTCTACCGGATACTGAC GGCTAAAAGACCGCGCACTGAC
    icl TGGGAGCAGCTGCACGACCTCG TGGGTCGGGATCAACACCTTC
    ponA1 GGGCGGCGGAGAAGGCGGTTGC ACGAAATGCGGCGGGTGGTAGATA
    uvrA CCGGCCGGGAAAGCATTGAGATAC CGTCGACCAGGGTGCGTAGATAGC
    pks2 CCGCACCCAGCCGACGCAAAAGAT GCCGCCGACGAAAACAAGCAGAAC
    ctpV CGGGTTTCGGCGGTGTTTGTCC CGGCCGCGCTCTTCCTGCTCCAC
    Rv3070 GTATTGGGTCCGTGTTGCGTTTTC CCATCTGGCGGTCCTCTCC
    Rv3843c TACGCCGGAGGACAGCAACTACG TACGGCGGCGCATCGAACAACTCC
    prrA GCTGGAACGCGGCTTACG CAGGTCGAATTCGCGCTTGGTCAG
PreviousNext
Back to top
Download PDF
Citation Tools
Analysis of Expression Profile of Mammalian Cell Entry (mce) Operons of Mycobacterium tuberculosis
Ashwani Kumar, Mridula Bose, Vani Brahmachari
Infection and Immunity Sep 2003, 71 (10) 6083-6087; DOI: 10.1128/IAI.71.10.6083-6087.2003

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Infection and Immunity article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Analysis of Expression Profile of Mammalian Cell Entry (mce) Operons of Mycobacterium tuberculosis
(Your Name) has forwarded a page to you from Infection and Immunity
(Your Name) thought you would be interested in this article in Infection and Immunity.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Analysis of Expression Profile of Mammalian Cell Entry (mce) Operons of Mycobacterium tuberculosis
Ashwani Kumar, Mridula Bose, Vani Brahmachari
Infection and Immunity Sep 2003, 71 (10) 6083-6087; DOI: 10.1128/IAI.71.10.6083-6087.2003
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Genes, Bacterial
Mycobacterium tuberculosis
Operon

Related Articles

Cited By...

About

  • About IAI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #IAIjournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0019-9567; Online ISSN: 1098-5522