Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Infection and Immunity
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Molecular Genomics

GeneticAnalysis of the Capsule Locus of Haemophilus influenzaeSerotypef

Sarah W. Satola, Patricia L. Schirmer, Monica M. Farley
Sarah W. Satola
Atlanta Veterans Affairs Medical Center and Department of Medicine, Emory University School of Medicine, Decatur, Georgia 30033
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Patricia L. Schirmer
Atlanta Veterans Affairs Medical Center and Department of Medicine, Emory University School of Medicine, Decatur, Georgia 30033
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Monica M. Farley
Atlanta Veterans Affairs Medical Center and Department of Medicine, Emory University School of Medicine, Decatur, Georgia 30033
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: mfarley@emory.edu
DOI: 10.1128/IAI.71.12.7202-7207.2003
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Genetic organization of the Hif capsule locus and adjacent DNA. Arrows indicate genes and ORFs. Region I contains four genes, on the opposite strand, homologous to those found in Hia and Hib, bexDCBA (left-hatched arrows). Region II is comprised of three serotype-specific genes designated fcs1, fcs2, and fcs3 (black arrows). Region III has two genes, hcsA and hcsB, also found in the cap locus of Hib (right-hatched arrows). Six additional ORFs outside of the Hif cap locus are noted with white arrows. Vertical lines show cleavage sites for restriction endonucleases EcoRI (E) and PstI (P). Horizontal lines below the restriction map show the locations and sizes of the probes used to identify cosmid clones with the Hif cap locus.

  • FIG. 2.
    • Open in new tab
    • Download powerpoint
    FIG. 2.

    fcs1, fcs2, and fcs3 expression detected in log-phase Hif 700222 cells and shown to be cotranscribed by RT-PCR. Lane 1, 1-kb standard marker (Promega Corp., Madison, Wis.); lanes 3, 6, 9, 12, and 15, RT negative controls; lanes 4, 7, 10, 13, and 16, positive controls with chromosomal DNA from Hif 700222 as template; lane 2, Fcs1-a and Fcs1-b RT (+); lane 5, Fcs2-a and Fcs2-b RT (+); lane 8, Fcs3-a and Fcs3-b RT (+); lane 11, Fcs1-2-a and Fcs1-2-b RT (+); lane 12, Fcs1-2-a and Fcs1-2-b RT (-); lane 13, Fcs1-2-a and Fcs1-2-b as PCR control; lane 14, Fcs2-3-a and Fcs2-3-b RT (+). Primers and product sizes are listed in Table 1.

  • FIG. 3.
    • Open in new tab
    • Download powerpoint
    FIG. 3.

    PCR analysis of the end junctions and outside DNA of the Hif cap locus and H. influenzae serotypes a and e. Lanes 1 and 14, 1-kb standard marker (Promega Corp.). Hif 700222 chromosomal DNA was amplified with primer pairs capfMerT and SodC 3970-2951 (lane 3), capfSodC and capfBexA (lane7), and capf region III and HI1637 (lane 11). Hia ATCC 9006 chromosomal DNA was amplified with primer pairs capfMerT and SodC 3970-2951 (lane 4), capfSodC and capfBexA (lane 8), and capf region III and HI1637 (lane 12). Hie ATCC 8142 chromosomal DNA was amplified with primer pairs capfMerT and SodC 3970-2951 (lane 5), capfSodC and capfBexA (lane 9), and capf region III and HI1637 (lane 13). Lanes 2, 6, and 10 are the no-template controls. Primers and product sizes are listed in Table 1.

Tables

  • Figures
  • TABLE 1.

    Oligonucleotide primer pairs used in RT-PCR of Fcs1, Fcs2, and Fcs3, analysis of the adjacent Hif cap DNA, and as probes in Southern blot hybridization

    Oligonucleotide nameSequence (5′-3′)Gene(s) (size [bp])Reference
    f1GCTACTATCCAAGTCCAAATCHif cap specific (450) 5
    f2CGCAATTATGGAAGAAAGCT 5
    HI-1CGTTTGTATGATGTTGATCCAGAC bexA (343) 5
    HI-2TGTCCATGTCTTCAAAATGATG 5
    ORF6GTTATTACTTGCGTGATCGT hcsB (311) 24
    Reg3bGCAATGGCACATCATGCACThis study
    Fcs1-aCGTGACGCATTGAATAATAAATAC fcs1 (720)This study
    Fcs1-bCTGTGCCTTAGCATTTGCGGAGThis study
    Fcs2-aGTTAATGCAAAAGATCAAG fcs2 (1,149)This study
    Fcs2-bCATAGTTATACCATGCTGTAACCThis study
    Fcs3-aCCGGGAATCCATAGAGTTCA fcs3 (992)This study
    Fcs3-bGAGCATTCTATAATATGCAATGGThis study
    Fcs1-2-aCGCTCCGCAAATGCTAA fcs1-fcs2 (323)This study
    Fcs1-2-bTTCTTCACTGTTATCAGGGCTACThis study
    Fcs2-3-aCGATGAATTATCTCTATCTTACAAGG fcs2-fcs3 (417)This study
    Fcs2-3-bCTGATGGTGTATGAACTCTATGThis study
    capfSodCCATGCGCATTTTCCACGCCAGC bexA-sodC (875)This study
    capfBexAGGGATTGAGGCGCAATGATTCGThis study
    capfMerTCCTTTTGGGTTGCCATAGCC merT-sodC (774)This study
    SodC 3970-2951CACTCAGATCATCCTGCTCCThis study
    capf region IIICAGTACGAGTGGTATTTCAG hcsB-HI1637 (700)This study
    HI1637AAATTTCCATTATGGGAAACGThis study
PreviousNext
Back to top
Download PDF
Citation Tools
GeneticAnalysis of the Capsule Locus of Haemophilus influenzaeSerotypef
Sarah W. Satola, Patricia L. Schirmer, Monica M. Farley
Infection and Immunity Nov 2003, 71 (12) 7202-7207; DOI: 10.1128/IAI.71.12.7202-7207.2003

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Infection and Immunity article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
GeneticAnalysis of the Capsule Locus of Haemophilus influenzaeSerotypef
(Your Name) has forwarded a page to you from Infection and Immunity
(Your Name) thought you would be interested in this article in Infection and Immunity.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
GeneticAnalysis of the Capsule Locus of Haemophilus influenzaeSerotypef
Sarah W. Satola, Patricia L. Schirmer, Monica M. Farley
Infection and Immunity Nov 2003, 71 (12) 7202-7207; DOI: 10.1128/IAI.71.12.7202-7207.2003
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • Cosmid sequencing and assembly of the Hif cap locus.
    • Sequence analysis of Hif cap locus regions I and III.
    • Sequence analysis of Hif cap locus region II.
    • Region II fcs1, fcs2, and fcs3 transcription.
    • Chromosomal location of Hif cap locus.
    • Nucleotide sequence accession number.
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Bacterial Capsules
Bacterial Proteins
Chromosome Mapping
Haemophilus influenzae

Related Articles

Cited By...

About

  • About IAI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #IAIjournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0019-9567; Online ISSN: 1098-5522