Article Figures & Data
Figures
- FIG. 1.
Genetic organization of the Hif capsule locus and adjacent DNA. Arrows indicate genes and ORFs. Region I contains four genes, on the opposite strand, homologous to those found in Hia and Hib, bexDCBA (left-hatched arrows). Region II is comprised of three serotype-specific genes designated fcs1, fcs2, and fcs3 (black arrows). Region III has two genes, hcsA and hcsB, also found in the cap locus of Hib (right-hatched arrows). Six additional ORFs outside of the Hif cap locus are noted with white arrows. Vertical lines show cleavage sites for restriction endonucleases EcoRI (E) and PstI (P). Horizontal lines below the restriction map show the locations and sizes of the probes used to identify cosmid clones with the Hif cap locus.
- FIG. 2.
fcs1, fcs2, and fcs3 expression detected in log-phase Hif 700222 cells and shown to be cotranscribed by RT-PCR. Lane 1, 1-kb standard marker (Promega Corp., Madison, Wis.); lanes 3, 6, 9, 12, and 15, RT negative controls; lanes 4, 7, 10, 13, and 16, positive controls with chromosomal DNA from Hif 700222 as template; lane 2, Fcs1-a and Fcs1-b RT (+); lane 5, Fcs2-a and Fcs2-b RT (+); lane 8, Fcs3-a and Fcs3-b RT (+); lane 11, Fcs1-2-a and Fcs1-2-b RT (+); lane 12, Fcs1-2-a and Fcs1-2-b RT (-); lane 13, Fcs1-2-a and Fcs1-2-b as PCR control; lane 14, Fcs2-3-a and Fcs2-3-b RT (+). Primers and product sizes are listed in Table 1.
- FIG. 3.
PCR analysis of the end junctions and outside DNA of the Hif cap locus and H. influenzae serotypes a and e. Lanes 1 and 14, 1-kb standard marker (Promega Corp.). Hif 700222 chromosomal DNA was amplified with primer pairs capfMerT and SodC 3970-2951 (lane 3), capfSodC and capfBexA (lane7), and capf region III and HI1637 (lane 11). Hia ATCC 9006 chromosomal DNA was amplified with primer pairs capfMerT and SodC 3970-2951 (lane 4), capfSodC and capfBexA (lane 8), and capf region III and HI1637 (lane 12). Hie ATCC 8142 chromosomal DNA was amplified with primer pairs capfMerT and SodC 3970-2951 (lane 5), capfSodC and capfBexA (lane 9), and capf region III and HI1637 (lane 13). Lanes 2, 6, and 10 are the no-template controls. Primers and product sizes are listed in Table 1.
Tables
- TABLE 1.
Oligonucleotide primer pairs used in RT-PCR of Fcs1, Fcs2, and Fcs3, analysis of the adjacent Hif cap DNA, and as probes in Southern blot hybridization
Oligonucleotide name Sequence (5′-3′) Gene(s) (size [bp]) Reference f1 GCTACTATCCAAGTCCAAATC Hif cap specific (450) 5 f2 CGCAATTATGGAAGAAAGCT 5 HI-1 CGTTTGTATGATGTTGATCCAGAC bexA (343) 5 HI-2 TGTCCATGTCTTCAAAATGATG 5 ORF6 GTTATTACTTGCGTGATCGT hcsB (311) 24 Reg3b GCAATGGCACATCATGCAC This study Fcs1-a CGTGACGCATTGAATAATAAATAC fcs1 (720) This study Fcs1-b CTGTGCCTTAGCATTTGCGGAG This study Fcs2-a GTTAATGCAAAAGATCAAG fcs2 (1,149) This study Fcs2-b CATAGTTATACCATGCTGTAACC This study Fcs3-a CCGGGAATCCATAGAGTTCA fcs3 (992) This study Fcs3-b GAGCATTCTATAATATGCAATGG This study Fcs1-2-a CGCTCCGCAAATGCTAA fcs1-fcs2 (323) This study Fcs1-2-b TTCTTCACTGTTATCAGGGCTAC This study Fcs2-3-a CGATGAATTATCTCTATCTTACAAGG fcs2-fcs3 (417) This study Fcs2-3-b CTGATGGTGTATGAACTCTATG This study capfSodC CATGCGCATTTTCCACGCCAGC bexA-sodC (875) This study capfBexA GGGATTGAGGCGCAATGATTCG This study capfMerT CCTTTTGGGTTGCCATAGCC merT-sodC (774) This study SodC 3970-2951 CACTCAGATCATCCTGCTCC This study capf region III CAGTACGAGTGGTATTTCAG hcsB-HI1637 (700) This study HI1637 AAATTTCCATTATGGGAAACG This study
