Article Figures & Data
Figures
- FIG. 1.
Colonization of intestinal and lymph tissues at day 1 and day 2 postinfection with 2 × 109 CFU of wild-type Y. pseudotuberculosis (filled diamonds), yopHEMOJ (open circles), or yopBHEMOJ (open triangles). Data from four to six mice from two experiments were pooled. Each symbol represents the log10 CFU/gram of tissue from one mouse colonized with the appropriate strain. All points were above the limit of detection of 10 CFU/gram of tissue. At day 1, colonization by yopHEMOJ and yopBHEMOJ was statistically different (**; P < 0.01) from that by the wild-type strain in the ileum, colon, and PP. At day 2, colonization by yopHEMOJ and yopBHEMOJ are statistically different from the wild-type strain (P < 0.01) in all tissues.
- FIG. 2.
Colonization of ileum, PP, and MLN at day 2 and day 5 postinfection with either 2 × 109 CFU or 2 × 108 CFU of wild-type (wt), yopB (ΔB), yopH (ΔH), yopE (ΔE), or yopO (ΔO) Y. pseudotuberculosis. Data from four to eight mice from two to four experiments were pooled. Each symbol represents the log10 CFU/gram of tissue for the tissue sample from one mouse. Shaded bars represent the average log10 CFU/gram of tissue. Open symbols indicate that less than 10 CFU were recovered/tissue. Asterisks indicate statistical significance of difference between colonization levels of yop mutants and wild-type bacteria as follows: *, P = 0.1 to 0.01; **, P < 0.01.
- FIG. 3.
Colonization of the spleen at 2 and 5 days postinfection with either 2 × 109 CFU or 2 × 108 CFU of wild-type (wt), yopB (ΔB), yopH (ΔH), yopE (ΔE), yopO (ΔO) or ΔHEMOJ Y. pseudotuberculosis. Data from four to eight mice from two to four experiments were pooled. Each symbol represents the log10 CFU/gram of tissue for the spleen from one mouse. Open symbols indicate that less than 10 CFU/tissue were recovered.
- FIG. 4.
Colonization of intestinal and lymph tissues at day 2 and day 5 postinfection with 2 × 108 CFU of wild-type, yopHE (ΔHE), yopHO (ΔHO), yopEO (ΔEO), yopHEO (ΔHEO), or yopHEMOJ (ΔHEMOJ) Y. pseudotuberculosis. Data from four to six mice from two to three experiments were pooled. Each symbol represents the log10 CFU/gram of tissue for the tissue sample from one mouse. Shaded bars represent the average log10 CFU/gram of tissue. Open symbols indicate that less than 10 CFU were recovered/tissue. Asterisks indicate statistical significance of difference between colonization levels of yop mutants and wild-type bacteria. *, P = 0.1 to 0.01; **, P < 0.01.
- FIG. 5.
Competition of yopHE versus yopHEMOJ (closed circles) and yopHEO versus yopHEMOJ (open circles), 1 day postinfection with 2 × 109 CFU of an equal mixture of yopHE and yopHEMOJ or yopHEO and yopHEMOJ. Data from three to six mice from two experiments were pooled. Data are graphed as C.I. {[yopHE(O)/yopHEMOJ output ratio]/[yopHE(O)/yopHEMOJ input ratio]} values for the tissue samples from one mouse. Shaded bars represent geometric means of the C.I. values. All points were above the limit of detection.
- FIG. 6.
Competition between wild-type Y. pseudotuberculosis and yop mutants at 5 days postinfection with 2 × 109 CFU of a mixture of equal amounts of the wild-type strain and either yopB, yopH, yopE, yopO, or yopHEMOJ. Data from six to eight mice from three to four experiments were pooled. Each point represents the C.I. [(mutant/wild-type output ratio)/(mutant/wild-type input ratio)] value for the tissue sample from one mouse. Shaded bars represent the geometric means of the C.I. values. Open symbols indicate that the yop mutant was below the limit of detection, which was usually 200 bacteria. Asterisks indicate the yop mutants that were significantly outcompeted by wild-type bacteria (*, P = 0.1 to 0.01; **, P < 0.01).
Tables
- TABLE 1.
Primers used to construct yop deletions
Primer Sequence YopE 1 GCACATGTCGACGAGCGTTGTATCTAATCCTG YopE 2 CGTCAGGAGCTCAGCATCCTGTCGGGCAAATA YopE 3 ACTGACGAGCTCGTATTCCCTTCTCGCAGTGG YopE 4 CTGATGCCCGGGCGAGTGCTGCATCAATCCATAG YopO 1 TCATGCGTCGACTCACATCCATTCCCGCTC YopO 2 GACGATGCATGCCACATAAGCACCTGGAAACGC YopO 3 CGTTACGCATGCAAGATTAGGATGTTTGCCCGC YopO 4 CTGCATGAGCTCGAGCGCATCAGCCAACATTGG YopB 1 CTATGCGTCGACTACGAGGATGCTCACAAGGTC YopB 2 AGCTGCGCATGCAGGCGCTGGTGTCTCGAC YopB 3 GTACGTGCATGCAAGGCAGACATGGCAGCG YopB 4 ATCTGCGAGCTCTTCTCGCGCTTTACGTGCCAG YopM 1 GTACCGTCGACTCAGCAGTAATACATTGGAC YopM 2 AGCGTGCATGCGACTGTAGATACATTTCTTGGATTTATG YopM 3 CAGTCGCATGCACGCTTTTGAGTAGTACGCAAGAG YopM 4 GATCCGAGCTCTGGTTCGTCCAGAAAAACG - TABLE 2.
Average log10 CFU/gram of tissue at day 2 and day 5 postinfection
Dose level and tissue Avg log10 CFU/g of tissue and log10 ratio on: Day 2 postinfection Day 5 postinfection wt avga,d ΔyopB ΔyopH ΔyopE ΔyopO wt avge ΔyopB ΔyopH ΔyopE ΔyopO Avgd Ratiob,c Avgd Ratio Avgd Ratio Avgd Ratio Avgd Ratiob,c Avge Ratio Avge Ratio Avge Ratio High Tissues Ileum 5.8 2.6 0.0006 5.5 0.44 4.8 0.09 5.5 0.48 4.9 2.8 0.01 4.7 0.79 4.3 0.26 4.6 0.62 Cecum 6.2 3.9 0.005 5.5 0.2 5.0 0.06 5.9 0.52 5.1 3.4 0.02 5.1 0.96 5.3 1.49 4.8 0.56 Colon 6.2 3.2 0.001 5.0 0.07 5.2 0.09 6.2 0.95 5.4 3.1 0.005 5.4 0.96 5.8 2.35 5.5 1.28 PP 7.0 3.8 0.0007 6.0 0.11 5.8 0.06 6.3 0.2 5.2 4.2 0.1 5.1 0.8 4.4 0.17 4.6 0.27 CLF 6.8 4.1 0.002 5.1 0.02 6.2 0.23 6.1 0.17 5.0 4.1 0.14 3.3 0.02 4.4 0.23 4.3 0.21 MLN 4.9 3.6 0.05 3.5 0.04 4.3 0.25 4.7 0.6 4.7 4.2 0.39 3.1 0.03 4.5 0.77 4.7 0.98 Spleen 2.9 2.1 0.17 2.8 0.95 2.1 0.17 2.6 0.52 4.2 2.3 0.01 2.6 0.02 2.3 0.012 3.4 0.15 Low Tissues Ileum 5.0 2.5 0.003 3.9 0.07 4.5 0.29 5.5 2.85 5.1 3.0 0.008 5.4 1.9 4.2 0.14 4.2 0.12 Cecum 5.8 2.6 0.0007 4.7 0.08 4.8 0.1 5.8 1 5.6 2.8 0.002 5.1 0.37 5.6 1.15 5.2 0.38 Colon 5.5 2.9 0.002 4.5 0.1 5.1 0.34 5.8 1.91 5.7 3.4 0.005 5.5 0.62 5.9 1.47 5.5 0.65 PP 6.6 2.7 0.0001 4.5 0.008 5.8 0.18 5.7 0.14 5.8 4.1 0.02 5.5 0.53 5.1 0.2 4.6 0.07 CLF 5.9 3.5 0.004 4.8 0.08 5.2 0.2 6.5 4.16 5.6 4.3 0.05 4.2 0.04 5.5 0.86 4.9 0.22 MLN 3.9 2.9 0.12 2.6 0.05 2.9 0.12 4.2 2.47 4.5 4.0 0.25 2.7 0.01 3.8 0.16 4.2 0.48 Spleen 3.2 2.1 0.08 2.1 0.08 2.3 0.11 2.9 0.45 4.2 2.7 0.03 2.2 0.01 2.0 0.007 3.0 0.06 ↵ a avg, average of log10 CFU/gram of tissues. wt, wild type.
↵ b Ratio of average log10 (CFU of mutant/gram of tissue)/(average log CFU of wild type/gram of tissue).
↵ c Significant differences from wild type are indicated as follows: boldface, P < 0.01; underlined values, P value is between 0.01 and 0.1.
↵ d n = four mice pooled from two experiments.
↵ e n = six to eight mice pooled from three to four experiments.
- TABLE 3.
Geometric mean of C.I. at day 2 and day 5a
Tissue C.I. geometric mean wt/wt Kan ΔyopB/wt Kan ΔyopH/wt Kan ΔyopE/wt Kan ΔyopO/wt Kan ΔyopHEMOJ/wt Kan day 5 Day 2 Day 5 Day 2 Day 5 Day 2 Day 5 Day 2 Day 5 Day 2 Day 5 Ileum 0.7 0.021 0.047 0.024 0.094 0.015 Cecum 0.85 0.63 0.008 0.009 0.19 0.026 0.26 0.078 0.58 0.2 0.006 Colon 0.45 0.01 0.014 0.073 0.24 0.005 PP 0.70 1.12 0.006 0.022 0.15 0.02 0.16 0.04 0.65 0.03 0.012 CL 0.89 0.013 0.017 0.085 0.11 0.005 MLN 0.81 0.54 0.051 0.032 0.07 0.02 0.19 0.2 0.82 0.097 0.012 ↵ a Geometric mean of the C.I. from six to eight mice pooled from three to four experiments. C.I. for mutant/wild type that were statistically significant from the C.I. for wild type/wild type are indicated as follows: boldface, P < 0.01; underlined characters, P value is between 0.01 and 0.1. wt, wild type.
