DOI: 10.1128/IAI.72.11.6711-6716.2004
Article Figures & Data
Figures
- FIG. 1.
Southern dot blot showing (a) SCOTS clones and (b) 1 μg (top) or 0.1 μg (bottom) of genomic A. pleuropneumoniae DNA as positive controls, hybridized to a radiolabeled probe generated from lung-derived (1) or culture-derived cDNA (2) after three rounds of normalization.
- FIG. 2.
PCR following reverse transcription of 5 μg of RNA derived from A. pleuropneumoniae-infected lung (lanes 1 to 5). Also shown is serial dilution of the cDNA template, ranging from undiluted (lane 1) to 1:10,000 (lane 5). Lanes a and b show positive controls using primer pairs oADH1/oADH2 (a) and oFLPD1/oFLPD2 (b), with chromosomal A. pleuropneumoniae DNA as template. −, No template.
Tables
- TABLE 1.
Characteristics of bacterial strains and primers used in this study
Strain, plasmid or primer Characteristics and/or sequences Source and/or reference Strains A. pleuropneumoniae C1569 A. pleuropneumoniae serotype 9, clinical isolate Diagnostic unit of the Department of Infectious Diseases Escherichia coli TOP10 F′ F− mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 rec A1 deoR araD139 Δ(araleu)7697 galU galK rpsL (Strr) endA1 nupG TOPO TA Cloning (Invitrogen) Plasmid pCR 2.1-TOPO Topoisomerase I enhanced E. coli cloning vector TOPO TA Cloning (Invitrogen) (35) Primers M13 forward 5′ CAGGAAACAGCTATGAC 3′ Amersham Biosciences M13 reverse 5′ GTAAAACGACGGCCAG 3′ Amersham Biosciences oSCOTS-N9-1 5′ GTGGTACCGCTCTCCGTCCGA-N9 3′ 8 oSCOTS-N9-2 5′ CGGGATCCAGCTTCTGACGCA-N9 3′ 8 oSCOTS1 5′ GTGGTACCGCTCTCCGTCCGA 3′ 8 oSCOTS2 5′ CGGGATCCAGCTTCTGACGCA 3′ 8 oRRN16-1 5′ TGGGTCGTAGGTTCAAATCC 3′ This work oRRN16-2 5′ GCGTCAGTACATTCCCAAGG 3′; amplifies 5′ end of 16s rRNA sequence; product size, 990 bp oRRN16-3 5′ TGTAGCGGTGAAATGCGTAG 3′ This work oRRN16-4 5′ ACTTGAACCACCGACCTCAC 3′; amplifies 3′ end of 16s rRNA sequence; product size, 1,000 bp oRRN23-1 5′ TTGGAAACAAGCTGAAAACTGA 3′ This work oRRN23-2 5′ GGACAGGAACCCTTGGTCTT 3′; amplifies 5′ end of 23s rRNA sequence; product size, 1,480 bp oRRN23-3 5′ TCAGAAGTGCGAATGCTGAC 3′ This work oRRN23-4 5′ CTGGCGAGACAACTGGTACA 3′; amplifies 3′ end of 23S rRNA sequence; product size, 1,466 bp oADH7 5′ ACACGTAATGACGGCGGTA 3′ This work oADH8 5′ CGAGTGGATTCACCCAATTT 3′; amplifies a 158-bp product from an A. pleuropneumoniae autotransporter adhesin; acc. no. ZP 00204542 oFLPD1 5′ TTTCTCTGTAGAGATGGTTTGTGC 3′ This work oFLPD2 5′ AACCCAATTAACCCAAATGGT 3′; amplifies a 154-bp product from an A. pleuropneumoniae fimbria-like protein; acc. no. NP 873737 - TABLE 2.
Genes identified via SCOTS
Class Clone(s) Gene and/or possible functiona % Identity/ % similarityb Spanc Reference(s)d GenBank accession no. Secreted H7 ApxIVA var3 RTX toxin (A. pleuropneumoniae) 33 AAD01905 Cell surface B5 Autotransporter adhesin, similar to Hsf in H. influenzae (A. pleuropneumoniae) 29, 39, 41 ZP_00204542 E4 flpD, fimbria-like protein (H. ducreyi); flp genes are essential for microcolony formation in H. ducreyi 65/66 188 12, 31, 37 NP_873737 B9 Outer membrane protein similar to immunogenic protein PomA of P. multocida (A. pleuropneumoniae) 13, 42 E47068 F4 Outer membrane protein of unknown function (A. pleuropneumoniae) ZP_00135264 Metabolism A7 guaA GMP synthase (A. pleuropneumoniae), linked to virulence in various organisms, including P. multocida 12, 27, 32, 34 ZP_00134556 A8 Diadenosine tetraphosphatase similar to ApaH in S. enterica serovar Typhimurium (A. pleuropneumoniae); linked to virulence in H. parasuis and serovar Typhimurium 21, 24 ZP_00134055 A9 fuc1, l-fucose isomerase (H. influenzae); in Bacteroides thetaiotaomicron, the l-fucose metabolic pathway is coordinated with the production of fucosylated glycans in enterocytes 76/78 222 22, 25 P44779 C2 ptsB, sucrose-specific phosphotransferase EII component (P. multocida); linked to virulence in serovar Typhimurium, S. aureus, and H. influenzae 83/85 216 28 NP_246785 H3 Sugar phosphate permease (A. pleuropneumoniae) ZP_00135166 C7 Oxygen-sensitive ribonucleoside-triphosphate reductase (A. pleuropneumoniae) ZP_00134686 D2 Thiol:disulfide interchange protein, similar to DsbA in H. influenzae (A. pleuropneumoniae); essential for virulence factor expression in P. aeruginosa 17, 34 ZP_00134426 D3 3-Polyprenyl-4-hydroxybenzoate decarboxylase (A. pleuropneumoniae) ZP_00134932 G6 Ribosomal protein RpS19 (H. influenzae) 100/100 90 P44385 E12 Biotin-(acetyl-coenzyme A carboxylase) ligase (A. pleuropneumoniae) ZP_00134488 F12 Dethiobiotin synthetase (A. pleuropneumoniae) ZP_00135280 F11 NADH ubiquinone oxidoreductase subunit 5 (A. pleuropneumoniae) 34 ZP_00135039 G8 SAM-dependent methyltransferase (A. pleuropneumoniae) 34 ZP_00134291 A4 Uncharacterized conserved protein involved in oxidation of intracellular sulfur (A. pleuropneumoniae) ZP_00133817 A11 Transposase (A. pleuropneumoniae) ZP_00134532 D1 3-Oxoacyl-(acyl-carrier protein) reductase (H. influenzae) 78/82 238 P43713 D4 Predicted GTPase (A. pleuropneumoniae) ZP_00134954 G11 ATPase (A. pleuropneumoniae) ZP_00134371 E9 Restriction-modification system (ALXA and HSDM, M . haemolytica); M. haemolytica AlxA activates leukotoxin transcription in E. coli 81/81 156 20 P95510 F8 Molybdopterin biosynthesis protein (H. ducreyi) 84/86 174 34 AAP95073 H6 Leucyl-tRNA synthetase (A. pleuropneumoniae) ZP_00133841 F9 Predicted hydrolase of alkaline phosphatase superfamily (A. pleuropneumoniae) ZP_00134565 Regulatory A3 rpoB, RNA polymerase subunit (H. ducreyi) 91/94 207 AAP96608 B2 Cell shape-determining protein, similar to MreC (A. pleuropneumoniae) ZP_00134717 A10 Signal recognition particle protein (H. influenzae) 88/93 243 P44518 H5 Molecular chaperone (A. pleuropneumoniae) ZP_00134922 H4 Putative transcriptional regulator (A. pleuropneumoniae) ZP_00134590 Stress C9 tufA, elongation factor (EF) Tu (H. ducreyi); EF-Tu acts as a fibronectin binding protein in M. pneumoniae, linked to virulence in K. pneumoniae 100/100 135 9, 40 NP_872680 Transport A5 apaA, putative ABC transporter, immunogenic (A. pleuropneumoniae) 30 AF109148 H1 dmsA, dimethyl sulfoxide reductase, catalytic subunit (A. pleuropneumoniae); deletion mutants are attenuated 2 AY138463 C4 hgbA, hemoglobin-binding protein (A. pleuropneumoniae); enables iron uptake from hemoglobin 5, 38 AAO33396 G1 Na+/H+ antiporter (A. pleuropneumoniae); essential for in vivo survival in S. agalactiae 27 ZP_00134319 E1 Predicted metal-binding protein (A. pleuropneumoniae) ZP_00135073 E7 Membrane components of Kef-type potassium transport systems (A. pleuropneumoniae) ZP_00134994 F1 Anaerobic C4-dicarboxylate transporter (A. pleuropneumoniae) 34 ZP_00134386 F2 tbpA, transferrin receptor; small subunit (A. pleuropneumoniae); upregulated and essential in vivo 1 CAA90896 F5 ATPase; cation transport (A. pleuropneumoniae) ZP_00135075 G10 Di- and tricarboxylate transporters (A. pleuropneumoniae) ZP_00135062 Unknown B8 Hypothetical protein PA2218 (P. aeruginosa) 76/83 162 Q01609 G7, F7e A. pleuropneumoniae; no homology to known genes ↵a Genes with highest similarity to SCOTS sequences, obtained from public databases, source organism in parentheses, genes names given where available. SAM, S-adenosylmethionine.
↵b Identity/similarity percentages apply to amino acids.
↵c Span means the number of nucleotides over which similarity was detected.
↵d Publications reporting the isolation of identical or similar sequences.
↵e Sequences have not been submitted as these are partial open reading frames only.
