Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Infection and Immunity
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Host Response and Inflammation

Mast Cells Limit Systemic Bacterial Dissemination but Not Colitis in Response to Citrobacter rodentium

Olivia L. Wei, Ashley Hilliard, Daniel Kalman, Melanie Sherman
Olivia L. Wei
Department of Pathology and Laboratory Medicine, Emory University, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ashley Hilliard
Department of Pathology and Laboratory Medicine, Emory University, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Daniel Kalman
Department of Pathology and Laboratory Medicine, Emory University, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Melanie Sherman
Department of Pathology and Laboratory Medicine, Emory University, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: msherma@emory.edu
DOI: 10.1128/IAI.73.4.1978-1985.2005
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

Enteropathogenic Escherichia coli and enterohemorrhagic E. coli cause an inflammatory colitis in human patients characterized by neutrophil infiltration, proinflammatory cytokine expression, and crypt hyperplasia. Citrobacter rodentium causes a similar colitis in mice and serves as a model for enteropathogenic E. coli infection in humans. C. rodentium induces systemic T-cell-dependent antibody production that facilitates clearance of the bacteria and protects the host from reinfection. The role of innate immune cells in infectious colitis, however, is less well understood. In this study, we have determined the role of mast cells in the inflammatory response and disease induced by C. rodentium. Mice deficient in mast cells exhibit more severe colonic histopathology and have a higher mortality rate following infection with C. rodentium than do wild-type animals. Despite unimpaired neutrophil recruitment and lymphocyte activation, mast cell-deficient mice have a disseminated infection evident in crucial organ systems that contributes to sepsis. Importantly, mast cells also have the capacity to directly kill C. rodentium. Together, these results suggest that mast cells protect the host from systemic infection by reducing the bacterial load and preventing dissemination of the bacterium from the colon.

Enteric pathogens such as enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) attach to and colonize the host gastrointestinal tract and cause weight loss, diarrhea, crypt hyperplasia, and transient colitis. EPEC is a major contaminant in food and water sources in developing countries and causes significant increases in morbidity and mortality, primarily among children. EHEC contaminates food and water sources in industrialized nations and causes both diarrhea and hemolytic-uremic syndrome. A related pathogen, Citrobacter rodentium, has only about 50% of its genes in common with EPEC and EHEC but nevertheless induces disease in rodents that is virtually identical to that caused by EPEC and EHEC in humans. C. rodentium infection in mice is widely used as an animal model of pathogenic E. coli infection in humans (7, 9, 10, 18-21, 34, 42, 43, 45-47).

EPEC, EHEC, and C. rodentium all induce a characteristic lesion in the intestine of the host that is characterized by intimate attachment to the host intestinal epithelial cells and effacement of microvilli. Such attaching and effacing (A/E) lesions result from translocation of virulence proteins from the bacterium into the host cell (13, 22, 23, 26). These factors induce formation of membranous protrusions, called pedestals, beneath the bacterium, and anchor the bacterium to the host cell (reviewed in reference 36). Pedestal formation is required for subsequent disease (31, 37). EPEC, EHEC, and C. rodentium all contain a 35-kb pathogenicity island called LEE (locus of enterocyte effacement) that encodes ∼41 virulence factors that are essential for the formation of A/E lesions and for disease. The virulence factors from the LEE loci of EPEC, EHEC, and C. rodentium are interchangeable (11, 16, 34).

Several observations suggest that inflammatory colitis induced by A/E pathogens results primarily from a deleterious host response induced by innate immune cells but not lymphocytes. First, application of heat-killed C. rodentium to artificially permeabilized colons causes an inflammatory disease that is nearly identical to that seen upon infection with live bacteria (21). Second, colonic inflammation, but not clearance, can occur in response to C. rodentium in the absence of B and T cells (42, 47). Finally, large numbers of neutrophils accumulate in the infected colon epithelium, creating crypt abscesses (21). Together, these data suggest that A/E lesions induce permeability of the epithelial barrier and that innate immune cells within the crypts or lamina propria, including epithelial cells, fibroblasts, mast cells, macrophages, and dendritic cells, appear capable of inducing inflammation and other symptoms associated with infectious colitis. These data and other evidence suggest that clearance of the bacterium additionally requires an adaptive immune response. For example, RAG1−/− mice, B-cell-deficient mice, and wild-type mice depleted of CD4+ T cells all develop severe colitis and large bacterial loads and have higher mortality in response to C. rodentium infection (7, 42, 47).

In contrast to the wealth of information on the requirement of the innate immune response for inflammation and the adaptive immune response for clearance and resolution of infection with C. rodentium, information on the precise mechanisms by which innate immune cells cause colonic inflammation is limited. In this paper, we focus on the role of mast cells in the inflammatory response to C. rodentium. Mast cells recognize and phagocytose bacteria, produce antimicrobial peptides (AMP), and secrete immunoregulatory cytokines (1, 2, 12, 27, 32, 49). In peritoneal infections, secretion of tumor necrosis factor alpha by mast cells causes recruitment of neutrophils, which then destroy the bacteria (14, 30). Mast cells also regulate ion secretion, water balance, and epithelial permeability, which can induce the diarrhea associated with enteric infection. For example, with mast cell-deficient rodents, Purdue and coworkers demonstrated that mast cells facilitate translocation of bacteria across the intestinal barrier in response to food allergens and are required for inflammation and antigen-induced diarrhea (5, 8, 38). Mast cells are responsible for the inflammation induced by cholera toxin A in the small intestine (50) and are implicated in gastritis induced by Helicobacter pylori (35). Together, these results suggest that mast cells participate in the initiation of colitis and inflammation in the intestinal tract.

Here we set out to investigate the role of mast cells in the inflammatory response to C. rodentium infection in mice that lack mast cells (W/Wv). Surprisingly, C. rodentium infection of W/Wv mice resulted in more severe inflammation in the colon and increased production of proinflammatory cytokines in the absence of mast cells. W/Wv mice also had increased mortality as a result of bacteremia and tissue damage. Thus, these data suggest that rather than mediating the inflammatory responses, mast cells play a crucial protective role in the clearance of an enteric pathogenic bacterial infection by preventing bacterial dissemination to extracolonic tissues and sepsis.

MATERIALS AND METHODS

Experimental animals and cell isolation.WBB6/F1-kitW/kitWv (W/Wv) (24) female mice (4 to 8 weeks old), their female congenic WBB6/F1-kit+/kit+ littermates (wild type), and female TCRβ−/− mice (33) were obtained from The Jackson Laboratory. Animal care was provided in accordance with protocols approved by the Institutional Animal Care and Use Committee of Emory University. To obtain bone marrow-derived mast cells (BMMC), bone marrow was harvested from both femurs of 6- to 8-week-old wild-type mice and cultured in complete RPMI medium (10% fetal bovine serum, 50 U of penicillin-streptomycin per ml, 50 μM 2-β-mercaptoethanol, 1 mM sodium pyruvate, 1× nonessential amino acids [Cellgro; Fisher]) supplemented with 1 ng of interleukin-3 per ml and 20 ng of stem cell factor (SCF) per ml (R&D Systems, Minneapolis, Minn.). BMMC were used after a minimum of 4 weeks in culture at >95% purity, as determined by flow cytometric analysis and toluidine blue staining. For reconstitution, BMMC (5 × 106 in 200 μl of phosphate-buffered saline [PBS]) were injected intravenously into W/Wv mice. Reconstituted mice were housed for 8 weeks following injection prior to infection with C. rodentium. Age-matched unreconstituted W/Wv and wild-type littermates were infected in the same experiment as controls. T cells were isolated from the spleens of wild-type and W/Wv mice with T-cell enrichment columns (R&D Systems) in accordance with the manufacturer's directions. T cells (5 × 107 in 200 μl of PBS) were injected intravenously into TCRβ−/− mice. Reconstituted mice were infected 48 h after reconstitution. Concanavalin A (ConA)-elicited polymorphonuclear neutrophils (PMN) were obtained by a single intraperitoneal injection of ConA (200 μg in 200 μl of PBS; Sigma). Six hours later, peritoneal cells were collected, washed three times, and used in killing assays. These cells were 80 to 90% PMN as identified by Giemsa stain (LabChem, Pittsburgh, Pa.). To obtain CD3+ T cells, spleens from wild-type mice were homogenized, red blood cells were hypotonically lysed, and the remaining cells were washed three times before application to T-cell enrichment columns in accordance with the manufacturer's (R&D Systems) directions.

Infection. C. rodentium (ATCC 51116) bacteria were prepared by overnight culturing at 37°C in Luria broth (Becton Dickinson) without shaking. Cultures were harvested by centrifugation and resuspended in 0.5 volume of PBS. Mice were orally inoculated by gavage with 200 μl of the bacterial suspension, which contained approximately 2.5 × 108 bacteria. The dosage was confirmed by retrospective plating on MacConkey agar; C. rodentium forms small pink colonies with white rims on this medium. Survival of infected mice and changes in body weight were monitored twice daily. Mice that lost more than 20% of their original weight were euthanized. For histology, colons, kidneys, and livers were removed at indicated times postinfection, fixed in 10% formalin, and embedded in paraffin. Sections (5 μm) were cut and stained with hematoxylin and eosin (H&E) or Giemsa stain. Crypt heights were measured by micrometry with a wide-field Zeiss microscope and Slidebook software (Intelligent Imaging Innovations). Well-oriented crypts were used for measurements, and data points represent three measurements of five colons per group. For colonization of tissues, small pieces (1 cm, approximately 0.2 g) of colon, liver, spleen, kidney, and lung were weighed and then homogenized at low speed with a Tissuemizer (Fisher) in 1 ml of PBS as previously described (7, 11, 18, 41, 42, 46, 47). Blood was collected from the mice by ocular sinus puncture daily after infection. Serial dilutions were plated on MacConkey agar plates. C. rodentium colonies were recognized as pink with a white rim on MacConkey agar as previously described (46). Random colonies were confirmed as C. rodentium by PCR with Tir-specific primers (forward primer GCGCGAATTCATGCCTATTGGTAATCTTGGTAATAATAAT and reverse primer GCGCCCCGGGTTAGACGAAACGTTCAACTCCCGGTGTTGT). Colonies were counted after 20 h of incubation at 37°C to determine the number of CFU per gram of tissue or per milliliter of blood. As expected, we found that blood and tissues from uninfected mice were not colonized by C. rodentium.

ELISA for C. rodentium-specific antibody.For antibody isotype analysis, antibody titers in sera were determined by enzyme-linked immunosorbent assay (ELISA). Plates were coated with 100 μl of 10 μg of C. rodentium lysate per ml in 0.1 M carbonate buffer and incubated overnight at 4°C. The plates were then blocked with blocking solution (0.2% bovine serum albumin-PBS-Tween 20) at 37°C for 2 h. Dilutions of serum starting at 1/10 to 1/20 were made with blocking solution, and 100 μl of each dilution was added to duplicate wells of coated plates. After incubation at room temperature for 4 h, the coated plates were washed with PBS-polyoxyethylene sorbitan monooleate (Tween 20; Sigma) and bound immunoglobulin (Ig) was detected with biotin-conjugated goat anti-mouse IgG1, IgG2a, and IgG2b at room temperature for 2 h. The plates were then washed with PBS-Tween 20, and 100 μl of a 1/1,000 dilution of streptavidin-horseradish peroxidase in blocking solution was added for 1 h at room temperature. After incubation, color was developed with tetramethylbenzidine (Promega), stopped with 0.18 N sulfuric acid, and measured by determination of optical density at 450 nm on a microplate reader (Biotek). The antibody titer was defined as the dilution required to reduce a positive signal to threefold above the background.

Flow cytometry.Cells were harvested from lymph nodes and spleens of infected W/Wv or wild-type mice and subsequently stained with fluorescein isothiocyanate-labeled rat anti-mouse CD44 or CD3, phycoerythrin-labeled anti-CD4 or -CD25, or allophycocyanin-labeled anti-CD8 monoclonal antibody in accordance with the manufacturer's (BD Bioscience, San Jose, Calif.) instructions. As isotype controls, we used the same concentration of rat IgG1, IgG2a, and IgG2b. To confirm mast cell differentiation and maturation, BMMC were blocked with antibodies to the Fcγ receptors CD16 and CD32. Cells were incubated with murine IgE and then stained with directly conjugated monoclonal antibodies to murine IgE and c-kit. Cell analysis was performed with a FACScalibur flow cytometer (Becton Dickinson & Co., Mountain View, Calif.) equipped with CellQuest software.

Killing assay. C. rodentium bacteria were cultured overnight in Luria broth and serially diluted in PBS. Bacteria (2.5 × 106 CFU) were added to 2.5 × 105 BMMC, PMN, or T cells in 300 μl of RPMI medium without antibiotics. For killing by supernatant, mast cells were plated at a concentration of 5 × 106/ml and cultured for 24 h. The supernatant was then harvested, and 100 μl of mast cell supernatant was used for the killing assay. After 1, 2, or 3 h, the bacterium-cell culture was diluted 1:10 in water for 10 min to lyse the cells (39) and serial dilutions were plated on MacConkey agar. Cultures were set up in triplicate, and the results reported are representative of at least three independent experiments.

MPO activity assay.Colon tissue samples (0.2 to 0.3 g) were homogenized in ice-cold potassium phosphate buffer (50 mM K2HPO4, 50 mM KH2PO4, pH 6.0) containing hexadecyltrimethylammonium bromide (0.5% [wt/vol]; Sigma). The homogenates were then subjected to three freeze-thaw cycles, followed by sonication on ice for 10 s at power 5 before centrifugation at 14,000 rpm (Forma Scientific centrifuge model no. 120) for 15 min at 4°C. Aliquots of each supernatant or MPO (myeloperoxidase) standard (14 μl; Sigma) were added to 200 μl of substrate (0.167 mg of o-dianisidine per ml, 0.0005% H2O2 in potassium phosphate buffer), and the A450 was measured with a plate reader (Biotek). Protein levels were measured by the bicinchoninic acid protein assay (Bio-Rad). MPO activity is expressed as units per milligram of protein. One unit of enzyme activity is defined as the amount that consumes 1 μmol of H2O2/min.

Statistical analysis.All data are presented as mean values (± the standard error of the mean) unless otherwise designated. Comparisons between groups were made with a two-tailed Student t test, and statistical significance was defined for all tests as a P value of less than 0.05.

RESULTS

Mast cells contribute to clearance of C. rodentium. To determine the role of mast cells in infectious colitis, we used a well-characterized mouse strain, WBB6F1-KitWkitWv (W/Wv) (24, 25). Signaling from c-kit, the receptor for SCF, is defective in W/Wv mice. Because SCF signaling is required for mast cell development, W/Wv mice lack >99% of mast cells (24), and our experiments showed no detectable mast cells in colon tissue as assessed by Giemsa staining (e.g., see Fig. 2C). Five-week-old wild-type mice showed little outward sign of disease after oral infection with C. rodentium. In contrast, age-matched W/Wv littermates had a ruffled appearance and a hunched posture and lost 10 to 20% of their original body weight. By day 7 postinfection, approximately 90% of W/Wv mice succumbed, compared to 0% of control wild-type littermates (Fig. 1A). Thus, mice lacking mast cells display greater morbidity and mortality after infection with C. rodentium.

FIG. 1.
  • Open in new tab
  • Download powerpoint
FIG. 1.

(A) Mast cell-deficient mice (n = 6, cross symbols) and their wild-type littermates (n = 6, square symbols) were infected with 2.5 × 108 CFU of C. rodentium. Five of six 5-week-old W/Wv mice died from the infection within 1 week, while their age-matched littermates survived the infection without apparent symptoms. (B to E) Histology and crypt heights of colons of wild-type and W/Wv mice. H&E-stained sections from colons of either uninfected or infected (for 10 days with C. rodentium) wild-type (A to D) or W/Wv mice are shown. The histology sections shown are from the lower lamina propria with focal polymorphonuclear infiltrate (N = neutrophils). (F) Quantification of crypt lengths. Colons of either infected with C. rodentium for 10 days or uninfected wild-type (WT) and W/Wv mice show similar crypt hyperplasia. Note that absence of mast cells had no detectable effect on crypt length.

A hallmark feature of C. rodentium infection is colonic hyperplasia measured as an increase in crypt length. Such increases in crypt length are typically evident at 7 days postinfection and maximal after 10 days. To determine whether mast cells contribute to colonic hyperplasia, we measured crypt lengths in wild-type and W/Wv mice left uninfected or infected with C. rodentium. Macroscopic thickening of the colon was observed in all infected mice (Fig. 1B to E), and crypt lengths increased to the same extent in wild-type and mast cell-deficient animals (Fig. 1F). Thus, although the absence of mast cells contributes to increased morbidity and mortality, it does not affect colonic hyperplasia.

To determine whether the greater morbidity and mortality of W/Wv mice are due to the absence of mast cells, we reconstituted 5-week-old W/Wv mice with cultured BMMC from wild-type mice. A second control W/Wv group was left unreconstituted. After 4 weeks, the age-matched control W/Wv mice, the reconstituted W/Wv mice, and age-matched wild-type littermates were infected with C. rodentium. Approximately 40% of W/Wv mice older than 8 weeks died, compared to 0% of age-matched controls. Reconstituted W/Wv mice displayed very mild symptoms upon infection with C. rodentium, similar to those observed among age-matched wild-type littermates (Fig. 2A). Thus, the survival of W/Wv mice showed some dependence on age, consistent with previous reports that older wild-type mice have less severe disease (28). Wild-type mice, reconstituted W/Wv mice, and surviving W/Wv mice were sacrificed on day 28, and the bacterial loads in their colons were quantitated by plating colonic homogenate on MacConkey agar plates (see Materials and Methods). C. rodentium was not evident in the colons of any mice, indicating that all had cleared the infection by this time (data not shown). These results suggest that the presence of mast cells decreases the morbidity and mortality associated with C. rodentium infection. Moreover, our observation that the W/Wv mice that survive the infection can clear the bacteria suggests that mast cells are not required for an adaptive immune response or clearance of the infection (see also below).

FIG. 2.
  • Open in new tab
  • Download powerpoint
FIG. 2.

Reconstitution of W/Wv mice with BMMC rescues the mice from dying. (A) Four-week-old W/Wv mice were intravenously injected with BMMC and housed for 4 to 8 weeks before infection. Age-matched, mast cell-deficient mice (n = 21), their wild-type (WT) littermates (n = 11), and mast cell-reconstituted mice (n = 8) were infected with 2.5 × 108 CFU of C. rodentium. All wild-type and reconstituted mice survived the infection without apparent disease symptoms, while 40% of the W/Wv mice died during the first 2 weeks. (B to D) Giemsa staining of colonic tissue from wild-type (magnification, ×63), W/Wv (magnification, ×20), and reconstituted W/Wv mice (magnification, ×63), respectively. Mast cells are heterochromatic granulated cells in the mucosal or perivascular tissue (arrows).

C. rodentium spreads from the colon in mice lacking mast cells.To measure bacterial loads in blood and in various tissues following infection, we cultured the bacteria present in blood or in homogenates of liver, lung, kidney, and spleen tissues of infected mice on MacConkey agar plates. After 7 days of infection, W/Wv mice had approximately 10-fold more bacteria in their colons than did reconstituted W/Wv mice, and C. rodentium was detectable in the blood, livers, lungs, kidneys, and spleens of W/Wv mice but not in the blood or tissues of reconstituted W/Wv mice (Fig. 3A and B). Consistent with the large bacterial load in the blood and peripheral organs of W/Wv mice, histological analysis revealed tissue necrosis and infiltration of neutrophils and T cells in focal abscesses in both the kidneys and livers of these mice (Fig. 3C). Together, large bacterial loads and histopathology are strong indicators of sepsis. No infiltration or signs of disease were evident in the kidneys or livers of wild-type mice or those of reconstituted W/Wv mice. These observations suggest that the presence of mast cells prevents dissemination of C. rodentium from the colon to the blood and tissues, and sepsis.

FIG. 3.
  • Open in new tab
  • Download powerpoint
FIG. 3.

Mast cells help to prevent dissemination of C. rodentium in vivo and protect mice from organ failure caused by sepsis. (A) C. rodentium escapes from the site of infection to the blood in mast cell-deficient mice. Blood was collected from W/Wv mice 6 days after infection, and 50 μl was plated onto MacConkey agar plates and incubated for 20 h at 37°C before the colonies were counted. (B) C. rodentium bacteria were detected in the livers, lungs, and kidneys of W/Wv mice but were absent in both wild-type and reconstituted W/Wv mice. Various tissues of mast cell-deficient mice (W/Wv), wild-type littermates, and BMMC-reconstituted W/Wv mice were harvested aseptically 7 days after infection (n = 6 to 11 mice in each group), and C. rodentium CFU were counted as described in Materials and Methods. *, P < 0.05 compared with wild-type animals. (C) H&E-stained sections from wild-type and W/Wv mice showing that, 7 days after C. rodentium infection, significant amounts of cells in the livers and kidneys of W/Wv undergo apoptosis (arrows), which ultimately contributes to death.

Neutrophil recruitment to the infected colon is independent of mast cells. C. rodentium induces a localized inflammatory response in the colon, characterized by infiltration of immune cells such as neutrophils and lymphocytes (21). W/Wv mice have been shown to be more susceptible to peritoneal infections caused by cecal ligation and puncture because of the absence of mast cell-derived tumor necrosis factor alpha. In these studies, neutrophils were not recruited to the peritoneum, which in turn resulted in greater bacterial loads and septic shock in the mast cell-deficient mice (14, 30). To investigate whether neutrophils are recruited to the colon in W/Wv mice infected with C. rodentium, we quantitated MPO levels in infected colon tissue from W/Wv and wild-type mice. In contrast to previous studies on peritoneal infections, MPO activity in the colons of W/Wv mice was two- to threefold greater than in wild-type mice, indicating that neutrophil recruitment to the colon is not impaired in the absence of mast cells (Fig. 4). In support of these results, we observed large numbers of neutrophils in the lamina propria of infected wild-type and W/Wv mice (Fig. 1D and E). To our knowledge, these data are the first to demonstrate a protective role for mast cells during a bacterial infection that is independent of neutrophil chemotaxis. T-cell activation and recruitment to the draining lymph nodes were also not affected by the absence of mast cells (see supplemental figure at http://kalmanlab.com/supplementary_figure.pdf ). C. rodentium-specific antibodies are induced by day 14 postinfection in both groups of mice, and IgG1 and IgG2b isotypes are dominant in both strains with no significant differences in levels (Fig. 5). Together, these results suggest that mast cells are not required for neutrophil recruitment to the colon or the activation of an adaptive immune response to C. rodentium.

FIG. 4.
  • Open in new tab
  • Download powerpoint
FIG. 4.

Neutrophil recruitment is independent of the presence of mast cells. MPO assay was used to examine neutrophil recruitment after infection of wild-type (WT) and W/Wv mice. Mast cell-deficient mice have two- to threefold more neutrophils in the colon than do wild-type mice (n = 6 to 11 mice in each group). *, P < 0.001 compared to wild-type mice.

FIG. 5.
  • Open in new tab
  • Download powerpoint
FIG. 5.

Humoral immunity to C. rodentium is not attenuated in mast cell-deficient mice. Serum IgG responses to C. rodentium were analyzed by ELISA 7 and 14 days postinfection (n = 6 to 10 mice in each group). *, P < 0.05 compared with resting cells. WT, wild type.

Secreted factors derived from mast cells kill C. rodentium in vitro.Our observation that the bacterial loads in W/Wv mice were greater than those in wild-type animals raises the possibility that mast cells directly reduce the bacterial load. Mast cells are known to bind to and phagocytose bacteria (reviewed in reference 15) and can also produce AMP (12). To test whether mast cells directly kill C. rodentium, live bacteria were mixed with cultured mast cells (BMMC) and bacterial survival was quantitated after 0, 1, and 3 h of incubation. Surprisingly, mast cells are more potent than ConA-elicited PMN in their bactericidal ability (Fig. 6B), while T cells do not kill bacteria as expected. Consistent with the ability of mast cells to produce antibacterial peptides, supernatant from cultured mast cells also kills C. rodentium (Fig. 6A). Because mast cells are numerous in perivascular tissue, these results raise the possibility that mast cells may protect the host by secreting antibacterial factors around blood vessels and thereby reducing the number of C. rodentium bacteria spreading to extracolonic tissues.

FIG. 6.
  • Open in new tab
  • Download powerpoint
FIG. 6.

Mast cells have potent antibacterial activity and directly kill C. rodentium in vitro. (A) Mast cells (MC; 5 × 105) and mast cell supernatant (MC sup; 5 × 105 cells/ml) kill C. rodentium bacteria (103 CFU) within 1 h of coculture in vitro. (B) Comparison of BMMC, ConA-elicited PMN, and CD3+ T cells in killing of C. rodentium after 3 h of culture (2.5 × 106 CFU of bacteria with 5 × 105 cells, for a multiplicity of infection of 5:1). Data are the mean ± the standard error of the mean of triplicate measurements at each time point and are representative of at least three independent experiments.

DISCUSSION

A/E pathogens, including EPEC, EHEC, and C. rodentium, cause disease characterized by intestinal inflammation and diarrhea. Previous reports suggest that the inflammatory response occurs following a breach of the intestinal barrier and is mediated by innate and adaptive immune mechanisms (20). Whereas the adaptive responses to A/E pathogens have been well characterized, innate immune responses have not. We provide evidence here that rather than contributing to the inflammatory response, mast cells protect the host from bacteremia and sepsis. This protective function of mast cells is novel; previous reports have suggested that mast cells initiate or exacerbate tissue damage because of their capacity to release proinflammatory mediators, for example, during multiple sclerosis, inflammatory arthritis, and atopic dermatitis (reviewed in reference 44).

Control of bacterial dissemination following C. rodentium infection in the colon has to date only been associated with adaptive immune responses. Increased mortality and greater bacterial loads in the peritoneal cavity are evident in CD4- and RAG-1-deficient mice infected with C. rodentium (7, 42, 47). Likewise, infection of μMT mice, which have an intact T-cell compartment but lack B cells, causes severe colitis and results in a greater pathogen burden in colonic and extracolonic tissues (7). Thus, protection from a disseminated infection and clearance appear to require both T and B cells. It is interesting that the protective T- and B-cell response to C. rodentium is systemic, not localized to the colon. In this regard, Bry and Brenner have demonstrated that αE integrin−/− mice, which are deficient in homing of lymphocytes to the intestinal mucosa and have impaired intestinal lymphoid responses, can still resolve a C. rodentium infection (7).

While an adaptive response appears necessary to control and clear an infection caused by C. rodentium, it does not appear to be sufficient. First, adaptive responses take up to 2 weeks to fully develop. Thus, innate immune cells may promote protection early in the infection or restrict the infection to the colon. Second, innate immune cells appear to offer protection against death associated with disseminated infection in mice lacking lymphocyte responses. For example, mortality rates of RAG 1−/− mice in response to C. rodentium infection vary from 5% (42) to 100% (7). Some of the variance in these studies may be attributable to factors such as age, commensal flora, and diet, all of which may contribute to the virulence of the bacteria (28, 48). Nevertheless, even taking these factors into account, a significant proportion of mice can survive a disseminated infection without T- or B-cell responses, suggesting that the innate immune system also participates in host protection. Our data provide evidence that mast cells may mediate such a protective response by directly killing the bacteria (Fig. 6).

The high mortality rate in mast cell-deficient mice after infection with C. rodentium appears to be due to bacteremia and sepsis, which are due not to an increase in the bacterial load in the colon but rather to an inability to limit the bacteria to this site. Bacteria are detected in the blood, livers-, and lungs of infected mice that lack mast cells (Fig. 3). The serum of these mice also has increased levels of alanine transaminase, which is associated with liver damage (data not shown), and liver and kidney sections showed evidence of necrosis and infiltration of inflammatory cells, symptoms commonly associated with sepsis. Notably, similar phenotypes are evident in mice lacking B- or T-cell responses (7, 29, 42, 47), suggesting that wild-type mice likely require several immune mechanisms to protect the host and clear the infection.

Our results indicate that mast cells do not participate in the recruitment of other innate immune effector cells to the infected colon, nor do they appear to have a protective role at this site. Accordingly, the large intestine has very few mast cells compared with the stomach, jejunum, and small intestine (17). Although mast cells have been shown to attract neutrophils to the peritoneum following infection with E. coli (14, 30), we find that neutrophil infiltration in C. rodentium-infected W/Wv mice is unimpaired, even enhanced, which suggests that other cell types can provide signals required for PMN recruitment to the colon. In accordance with this idea, EPEC has been found to induce epithelial cells to produce interleukin-8 and stimulate neutrophil migration in vitro (40).

Our data do suggest several means by which mast cells protect the host systemically from bacteremia and sepsis following infection. First, mast cells may facilitate tissue repair of epithelial monolayers and thereby prevent further bacterial entry. A critical component of the disease process induced by A/E pathogens is a breach in epithelial barrier integrity. Genes within the LEE pathogenicity island, a locus present in all A/E pathogens, appear to mediate such breaches, and a barrier breach is required for the development of inflammation (20). Mechanisms within epithelial cells may participate in repairing the monolayer; in vitro evidence indicates that primary epithelial cells grow to contact inhibition following wounding of the monolayer. To date, little information is available on intrinsic mechanisms of wound healing after A/E bacterial infection. However, mast cells have been implicated in tissue repair of heart epithelial tissue following ischemia in vivo (3) and have been shown to be a rich source of epithelial and fibroblast growth factors (4) that stimulate epithelial cell growth. Thus, it is possible that mast cells in the intestinal mucosa repair breaks between cells in the colonic epithelium, thereby restoring barrier integrity and preventing continued bacterial access. To test this hypothesis, experiments are currently under way to determine whether mast cells home to barrier breach sites during infection.

A second mechanism by which mast cells may protect the host from bacteremia and sepsis is to kill bacteria directly. We present evidence showing that mast cells can kill C. rodentium by secreting a factor or factors with antimicrobial activity. Di Nardo et al. have shown that AMP are present in mast cells and are secreted upon stimulation with various bacteria (12). Up to 45 separate AMP-encoding genes are contained in the mouse genome (6), and it has been demonstrated that the expression of two of these AMP, mBD-1 and mBD-3, was upregulated in colon tissue following infection with C. rodentium (43). We have preliminary data showing that mast cells produce mBD-3 and that mBD-3, but not mBD-1, is sufficient to kill C. rodentium (O.L.W., unpublished observations). Whether the bactericidal activity of mast cells is due to mBD-3, or another AMP, is under investigation. Killing of bacteria in the colon by AMP may not be mediated exclusively by mast cells; epithelial cells also express AMP. Moreover, the colon may not be the only site where killing occurs. As noted above, systemic immune responses are required for clearance. Mast cells are present in large numbers in the fibroblast layers surrounding blood vessels, and mast cells at these sites may prevent access of spreading bacteria to organ systems. Testing of this model is currently under way with mutant strains of C. rodentium resistant to killing by AMP.

In summary, secretion of AMP by several cell types, including mast cells, may be required to control the bacterial load systemically and thereby restrict the infection to the colon. In the absence of mast cells, unrestricted bacterial growth appears to permit the bacteria to reach extracolonic sites and cause tissue damage. Mast cells may also repair barrier breaches in the intestinal epithelium and prevent continued access of bacteria to submucosal space. Failure of mast cells to perform these functions may result in sepsis and death following enteric infection.

ACKNOWLEDGMENTS

D.K. and M.S. contributed equally to this work.

This work was supported by grants R01-AI056067-01 (to D.K.) and K01-AR02157 from the National Institutes of Health and by a seed grant from the University Research Council, Emory University (to M.A.S.).

We thank Melissa Brown and Peter Jensen for helpful discussions and for commenting on the manuscript.

FOOTNOTES

    • Received 30 June 2004.
    • Returned for modification 20 September 2004.
    • Accepted 8 November 2004.
  • Copyright © 2005 American Society for Microbiology

REFERENCES

  1. 1.↵
    Arock, M., E. Ross, R. Lai-Kuen, G. Averlant, Z. Gao, and S. N. Abraham. 1998. Phagocytic and tumor necrosis factor alpha response of human mast cells following exposure to gram-negative and gram-positive bacteria. Infect. Immun.66:6030-6034.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    Arock, M., C. Zuany-Amorim, M. Singer, M. Benhamou, and M. Pretolani. 1996. Interleukin-10 inhibits cytokine generation from mast cells. Eur. J. Immunol.26:166-170.
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    Artuc, M., B. Hermes, U. M. Steckelings, A. Grutzkau, and B. M. Henz. 1999. Mast cells and their mediators in cutaneous wound healing—active participants or innocent bystanders? Exp. Dermatol.8:1-16.
    OpenUrlCrossRefPubMedWeb of Science
  4. 4.↵
    Artuc, M., U. M. Steckelings, and B. M. Henz. 2002. Mast cell-fibroblast interactions: human mast cells as source and inducers of fibroblast and epithelial growth factors. J. Investig. Dermatol.118:391-395.
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Berin, M. C., A. J. Kiliaan, P. C. Yang, J. A. Groot, Y. Kitamura, and M. H. Perdue. 1998. The influence of mast cells on pathways of transepithelial antigen transport in rat intestine. J. Immunol.161:2561-2566.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    Boman, H. G. 2003. Antibacterial peptides: basic facts and emerging concepts. J. Intern. Med.254:197-215.
    OpenUrlCrossRefPubMedWeb of Science
  7. 7.↵
    Bry, L., and M. B. Brenner. 2004. Critical role of T cell-dependent serum antibody, but not the gut-associated lymphoid tissue, for surviving acute mucosal infection with Citrobacter rodentium, an attaching and effacing pathogen. J. Immunol.172:433-441.
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    Crowe, S. E., K. Soda, A. M. Stanisz, and M. H. Perdue. 1993. Intestinal permeability in allergic rats: nerve involvement in antigen-induced changes. Am. J. Physiol.264:G617-G623.
    OpenUrl
  9. 9.↵
    Deng, W., Y. Li, B. A. Vallance, and B. B. Finlay. 2001. Locus of enterocyte effacement from Citrobacter rodentium: sequence analysis and evidence for horizontal transfer among attaching and effacing pathogens. Infect. Immun.69:6323-6335.
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Vazquez, J. Barba, J. A. Ibarra, P. O'Donnell, P. Metalnikov, K. Ashman, S. Lee, D. Goode, T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci. USA101:3597-3602.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    Deng, W., B. A. Vallance, Y. Li, J. L. Puente, and B. B. Finlay. 2003. Citrobacter rodentium translocated intimin receptor (Tir) is an essential virulence factor needed for actin condensation, intestinal colonization and colonic hyperplasia in mice. Mol. Microbiol.48:95-115.
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.↵
    Di Nardo, A., A. Vitiello, and R. L. Gallo. 2003. Cutting edge: mast cell antimicrobial activity is mediated by expression of cathelicidin antimicrobial peptide. J. Immunol.170:2274-2278.
    OpenUrlAbstract/FREE Full Text
  13. 13.↵
    Donnenberg, M. S., J. Yu, and J. B. Kaper. 1993. A second chromosomal gene necessary for intimate attachment of enteropathogenic Escherichia coli to epithelial cells. J. Bacteriol.175:4670-4680.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    Echtenacher, B., D. N. Mannel, and L. Hultner. 1996. Critical protective role of mast cells in a model of acute septic peritonitis. Nature381:75-77.
    OpenUrlCrossRefPubMedWeb of Science
  15. 15.↵
    Feger, F., S. Varadaradjalou, Z. Gao, S. N. Abraham, and M. Arock. 2002. The role of mast cells in host defense and their subversion by bacterial pathogens. Trends Immunol.23:151-158.
    OpenUrlCrossRefPubMedWeb of Science
  16. 16.↵
    Frankel, G., O. Lider, R. Hershkoviz, A. Mould, S. Kachalsky, D. Candy, L. Cahalon, M. Humphries, and G. Dougan. 1996. The cell-binding domain of intimin from enteropathogenic Escherichia coli binds to β1 integrins. J. Biol. Chem.271:20359-20364.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    Fukao, T., T. Yamada, M. Tanabe, Y. Terauchi, T. Ota, T. Takayama, T. Asano, T. Takeuchi, T. Kadowaki, J. Hata Ji, and S. Koyasu. 2002. Selective loss of gastrointestinal mast cells and impaired immunity in PI3K-deficient mice. Nat. Immunol.3:295-304.
    OpenUrlCrossRefPubMedWeb of Science
  18. 18.↵
    Goncalves, N. S., M. Ghaem-Maghami, G. Monteleone, G. Frankel, G. Dougan, D. J. Lewis, C. P. Simmons, and T. T. MacDonald. 2001. Critical role for tumor necrosis factor alpha in controlling the number of lumenal pathogenic bacteria and immunopathology in infectious colitis. Infect. Immun.69:6651-6659.
    OpenUrlAbstract/FREE Full Text
  19. 19.
    Gruenheid, S., I. Sekirov, N. A. Thomas, W. Deng, P. O'Donnell, D. Goode, Y. Li, E. A. Frey, N. F. Brown, P. Metalnikov, T. Pawson, K. Ashman, and B. B. Finlay. 2004. Identification and characterization of NleA, a non-LEE-encoded type III translocated virulence factor of enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol.51:1233-1249.
    OpenUrlCrossRefPubMedWeb of Science
  20. 20.↵
    Higgins, L. M., G. Frankel, I. Connerton, N. S. Goncalves, G. Dougan, and T. T. MacDonald. 1999. Role of bacterial intimin in colonic hyperplasia and inflammation. Science285:588-591.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    Higgins, L. M., G. Frankel, G. Douce, G. Dougan, and T. T. MacDonald. 1999. Citrobacter rodentium infection in mice elicits a mucosal Th1 cytokine response and lesions similar to those in murine inflammatory bowel disease. Infect. Immun.67:3031-3039.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B. Finlay. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell91:511-520.
    OpenUrlCrossRefPubMedWeb of Science
  23. 23.↵
    Kenny, B., L. C. Lai, B. B. Finlay, and M. S. Donnenberg. 1996. EspA, a protein secreted by enteropathogenic Escherichia coli, is required to induce signals in epithelial cells. Mol. Microbiol.20:313-323.
    OpenUrlCrossRefPubMedWeb of Science
  24. 24.↵
    Kitamura, Y., S. Go, and K. Hatanaka. 1978. Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation. Blood52:447-452.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    Kitamura, Y., M. Shimada, S. Go, H. Matsuda, K. Hatanaka, and M. Seki. 1979. Distribution of mast-cell precursors in hematopoietic and lymphopoietic tissues of mice. J. Exp. Med.150:482-490.
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    Lai, L. C., L. A. Wainwright, K. D. Stone, and M. S. Donnenberg. 1997. A third secreted protein that is encoded by the enteropathogenic Escherichia coli pathogenicity island is required for transduction of signals and for attaching and effacing activities in host cells. Infect. Immun.65:2211-2217.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    Lin, T. J., R. Garduno, R. T. Boudreau, and A. C. Issekutz. 2002. Pseudomonas aeruginosa activates human mast cells to induce neutrophil transendothelial migration via mast cell-derived IL-1 α and β. J. Immunol.169:4522-4530.
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    Luperchio, S. A., and D. B. Schauer. 2001. Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect.3:333-340.
    OpenUrlCrossRefPubMedWeb of Science
  29. 29.↵
    Maaser, C., M. P. Housley, M. Iimura, J. R. Smith, B. A. Vallance, B. B. Finlay, J. R. Schreiber, N. M. Varki, M. F. Kagnoff, and L. Eckmann. 2004. Clearance of Citrobacter rodentium requires B cells but not secretory immunoglobulin A (IgA) or IgM antibodies. Infect. Immun.72:3315-3324.
    OpenUrlAbstract/FREE Full Text
  30. 30.↵
    Malaviya, R., T. Ikeda, E. Ross, and S. N. Abraham. 1996. Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-α. Nature381:77-80.
    OpenUrlCrossRefPubMedWeb of Science
  31. 31.↵
    McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol. Microbiol.23:399-407.
    OpenUrlCrossRefPubMedWeb of Science
  32. 32.↵
    Mercer-Jones, M. A., M. S. Shrotri, M. Heinzelmann, J. C. Peyton, and W. G. Cheadle. 1999. Regulation of early peritoneal neutrophil migration by macrophage inflammatory protein-2 and mast cells in experimental peritonitis. J. Leukoc. Biol.65:249-255.
    OpenUrlPubMedWeb of Science
  33. 33.↵
    Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara, J. J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, et al. 1992. Mutations in T-cell antigen receptor genes alpha and beta block thymocyte development at different stages. Nature360:225-231.
    OpenUrlCrossRefPubMed
  34. 34.↵
    Mundy, R., L. Petrovska, K. Smollett, N. Simpson, R. K. Wilson, J. Yu, X. Tu, I. Rosenshine, S. Clare, G. Dougan, and G. Frankel. 2004. Identification of a novel Citrobacter rodentium type III secreted protein, EspI, and roles of this and other secreted proteins in infection. Infect. Immun.72:2288-2302.
    OpenUrlAbstract/FREE Full Text
  35. 35.↵
    Nakajima, S., B. Krishnan, H. Ota, A. M. Segura, T. Hattori, D. Y. Graham, and R. M. Genta. 1997. Mast cell involvement in gastritis with or without Helicobacter pylori infection. Gastroenterology113:746-754.
    OpenUrlCrossRefPubMedWeb of Science
  36. 36.↵
    Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev.11:142-201.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    Newman, J. V., B. A. Zabel, S. S. Jha, and D. B. Schauer. 1999. Citrobacter rodentium espB is necessary for signal transduction and for infection of laboratory mice. Infect. Immun.67:6019-6025.
    OpenUrlAbstract/FREE Full Text
  38. 38.↵
    Perdue, M. H., S. Masson, B. K. Wershil, and S. J. Galli. 1991. Role of mast cells in ion transport abnormalities associated with intestinal anaphylaxis. Correction of the diminished secretory response in genetically mast cell-deficient W/Wv mice by bone marrow transplantation. J. Clin. Investig.87:687-693.
    OpenUrlCrossRefPubMedWeb of Science
  39. 39.↵
    Rakita, R. M., N. N. Vanek, K. Jacques-Palaz, M. Mee, M. M. Mariscalco, G. M. Dunny, M. Snuggs, W. B. Van Winkle, and S. I. Simon. 1999. Enterococcus faecalis bearing aggregation substance is resistant to killing by human neutrophils despite phagocytosis and neutrophil activation. Infect. Immun.67:6067-6075.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    Savkovic, S. D., A. Koutsouris, and G. Hecht. 1996. Attachment of a noninvasive enteric pathogen, enteropathogenic Escherichia coli, to cultured human intestinal epithelial monolayers induces transmigration of neutrophils. Infect. Immun.64:4480-4487.
    OpenUrlAbstract/FREE Full Text
  41. 41.↵
    Schauer, D. B., and S. Falkow. 1993. The eae gene of Citrobacter freundii biotype 4280 is necessary for colonization in transmissible murine colonic hyperplasia. Infect. Immun.61:4654-4661.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    Simmons, C. P., S. Clare, M. Ghaem-Maghami, T. K. Uren, J. Rankin, A. Huett, R. Goldin, D. J. Lewis, T. T. MacDonald, R. A. Strugnell, G. Frankel, and G. Dougan. 2003. Central role for B lymphocytes and CD4+ T cells in immunity to infection by the attaching and effacing pathogen Citrobacter rodentium. Infect. Immun.71:5077-5086.
    OpenUrlCrossRefPubMedWeb of Science
  43. 43.↵
    Simmons, C. P., N. S. Goncalves, M. Ghaem-Maghami, M. Bajaj-Elliott, S. Clare, B. Neves, G. Frankel, G. Dougan, and T. T. MacDonald. 2002. Impaired resistance and enhanced pathology during infection with a noninvasive, attaching-effacing enteric bacterial pathogen, Citrobacter rodentium, in mice lacking IL-12 or IFN-γ. J. Immunol.168:1804-1812.
    OpenUrlAbstract/FREE Full Text
  44. 44.↵
    Theoharides, T. C., and D. E. Cochrane. 2004. Critical role of mast cells in inflammatory diseases and the effect of acute stress. J. Neuroimmunol.146:1-12.
    OpenUrlCrossRefPubMedWeb of Science
  45. 45.↵
    Vallance, B. A., W. Deng, M. De Grado, C. Chan, K. Jacobson, and B. B. Finlay. 2002. Modulation of inducible nitric oxide synthase expression by the attaching and effacing bacterial pathogen Citrobacter rodentium in infected mice. Infect. Immun.70:6424-6435.
    OpenUrlAbstract/FREE Full Text
  46. 46.↵
    Vallance, B. A., W. Deng, K. Jacobson, and B. B. Finlay. 2003. Host susceptibility to the attaching and effacing bacterial pathogen Citrobacter rodentium. Infect. Immun.71:3443-3453.
    OpenUrlAbstract/FREE Full Text
  47. 47.↵
    Vallance, B. A., W. Deng, L. A. Knodler, and B. B. Finlay. 2002. Mice lacking T and B lymphocytes develop transient colitis and crypt hyperplasia yet suffer impaired bacterial clearance during Citrobacter rodentium infection. Infect. Immun.70:2070-2081.
    OpenUrlAbstract/FREE Full Text
  48. 48.↵
    Varcoe, J. J., G. Krejcarek, F. Busta, and L. Brady. 2003. Prophylactic feeding of Lactobacillus acidophilus NCFM to mice attenuates overt colonic hyperplasia. J. Food Prot.66:457-465.
    OpenUrlPubMedWeb of Science
  49. 49.↵
    Von Stebut, E., M. Metz, G. Milon, J. Knop, and M. Maurer. 2003. Early macrophage influx to sites of cutaneous granuloma formation is dependent on MIP-1α/β released from neutrophils recruited by mast cell-derived TNFα. Blood101:210-215.
    OpenUrlAbstract/FREE Full Text
  50. 50.↵
    Wershil, B. K., I. Castagliuolo, and C. Pothoulakis. 1998. Direct evidence of mast cell involvement in Clostridium difficile toxin A-induced enteritis in mice. Gastroenterology114:956-964.
    OpenUrlCrossRefPubMedWeb of Science
PreviousNext
Back to top
Download PDF
Citation Tools
Mast Cells Limit Systemic Bacterial Dissemination but Not Colitis in Response to Citrobacter rodentium
Olivia L. Wei, Ashley Hilliard, Daniel Kalman, Melanie Sherman
Infection and Immunity Mar 2005, 73 (4) 1978-1985; DOI: 10.1128/IAI.73.4.1978-1985.2005

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Infection and Immunity article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Mast Cells Limit Systemic Bacterial Dissemination but Not Colitis in Response to Citrobacter rodentium
(Your Name) has forwarded a page to you from Infection and Immunity
(Your Name) thought you would be interested in this article in Infection and Immunity.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Mast Cells Limit Systemic Bacterial Dissemination but Not Colitis in Response to Citrobacter rodentium
Olivia L. Wei, Ashley Hilliard, Daniel Kalman, Melanie Sherman
Infection and Immunity Mar 2005, 73 (4) 1978-1985; DOI: 10.1128/IAI.73.4.1978-1985.2005
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Citrobacter rodentium
colitis
colon
mast cells

Related Articles

Cited By...

About

  • About IAI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #IAIjournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0019-9567; Online ISSN: 1098-5522