Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Infection and Immunity
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Errata

Temporal Expression of Enteropathogenic Escherichia coli Virulence Genes in an In Vitro Model of Infection

Laura Q. Leverton, James B. Kaper*
Laura Q. Leverton
1Department of Microbiology and Immunology
2Center for Vaccine Development, School of Medicine, University of Maryland, Baltimore, Maryland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
James B. Kaper*
1Department of Microbiology and Immunology
2Center for Vaccine Development, School of Medicine, University of Maryland, Baltimore, Maryland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/IAI.73.4.2570.2005
  • Article
  • Info & Metrics
  • PDF
Loading

Volume 73, no. 2, pages 1034-1043, 2005. Page 1035, Table 2, row 1, column 3, reverse primer for ler: “ACCAGGTCTGCCCTTGTTGA” should read “ACCAGGTCTGCCCTTCTTCA.”

Row 4, column 3, reverse primer for eae: “GATTAACCTATGCCGTTCCA” should read “GATTAACCTCTGCCGTTCCA.”

  • Copyright © 2005 American Society for Microbiology
PreviousNext
Back to top
Download PDF
Citation Tools
Temporal Expression of Enteropathogenic Escherichia coli Virulence Genes in an In Vitro Model of Infection
Laura Q. Leverton, James B. Kaper*
Infection and Immunity Mar 2005, 73 (4) 2570; DOI: 10.1128/IAI.73.4.2570.2005

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Infection and Immunity article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Temporal Expression of Enteropathogenic Escherichia coli Virulence Genes in an In Vitro Model of Infection
(Your Name) has forwarded a page to you from Infection and Immunity
(Your Name) thought you would be interested in this article in Infection and Immunity.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Temporal Expression of Enteropathogenic Escherichia coli Virulence Genes in an In Vitro Model of Infection
Laura Q. Leverton, James B. Kaper*
Infection and Immunity Mar 2005, 73 (4) 2570; DOI: 10.1128/IAI.73.4.2570.2005
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
  • Info & Metrics
  • PDF

KEYWORDS

Escherichia coli
gene expression
Gram-Negative Bacterial Infections

Related Articles

Cited By...

About

  • About IAI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #IAIjournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0019-9567; Online ISSN: 1098-5522