Article Figures & Data
Figures
- FIG. 1.
Growth of F. tularensis LVS under iron-replete and iron-restricted conditions. F. tularensis LVS was grown overnight on an MH+ agar plate. For iron-replete growth (filled circles), bacteria from the plate were inoculated into 1 ml of MH+ broth and grown at 37°C overnight. This overnight culture was then used to inoculate 10 ml MH+ broth to an OD600 of 0.05. For iron-restricted growth, the overnight culture was obtained by inoculating the bacteria from the plate into 1 ml MH− broth. This overnight culture was used to inoculate 20 ml of MH−/DF broth. When the culture reached an OD600 of 0.4, the 20-ml MH−/DF culture was divided into two cultures of 10 ml each. Fe-PPi was added to a final concentration of 330 μM in one culture (filled triangles), whereas an equivalent volume of sterile H2O was added to the other culture (open triangles).
- FIG. 2.
Identification of F. tularensis LVS proteins with increased expression under iron-restricted conditions. F. tularensis LVS cells were grown to stationary phase under both iron-replete (lane 1) and iron-restricted (lane 2) conditions. Cell envelopes and whole-cell lysates were prepared as described in Materials and Methods. (A) Proteins in cell envelopes were resolved by SDS-PAGE and stained with Coomassie blue. Molecular mass standards are present in the far left lane. The black arrow indicates the IglC protein, and the white arrow indicates the PdpB protein. Proteins in cell envelopes (B) or in whole-cell lysates (C) were resolved by SDS-PAGE, electrophoretically transferred to nitrocellulose membranes, and probed in a Western blot analysis with polyclonal mouse antiserum to PdpB (B) or FigA (C).
- FIG. 3.
Putative Fur boxes associated with the F. tularensis Schu4 pdpB, iglC, and figA ORFs. The ClustalW alignment was accomplished with the MacVector 6.5.3 software. The consensus Fur box is outlined. Identical bases in each pair are underlined and bold; nonidentity is indicated by italics.
- FIG. 4.
F. tularensis Schu4 figA and adjacent ORFs. (A) Schematic drawing. (B) RT-PCR analysis of possible transcriptional linkage between figA and adjacent ORFs. RT-PCR was carried out as described in Materials and Methods, with oligonucleotide primer pairs spanning intergenic regions 1 (5′-GTGCTGAAATGATTGACTATAGTCTC-3′ and 5′-CTTGTCATTGTTTATATTGTAGAAGAATA-3′), 2 (5′-AGTGCGATAAAGATGACATGC-3′ and 5′-TAGCTGCTATGATTATAAGC-3′), 3 (5′-TATCTATTTGACCTTAAATC-3′ and 5′-TGAATAATTGTTTCAATTTG-3′), and 4 (5′-TCAATACCAAGTTCTCAGAG-3′ and 5′-ACCTAAAAACCATGTTAAAAG-3′), respectively. Lanes 1, 4, 7, and 10, PCR products derived from F. tularensis LVS chromosomal DNA. The sizes of these PCR products are 547 bp (lane 1), 135 bp (lane 4), 120 bp (lane 7), and 121 bp (lane 10). Lanes 2, 5, 8, and 11, RT-PCR negative controls lacking reverse transcriptase. Lanes 3, 6, 9, and 12, products obtained when these same primers were used in an RT-PCR with F. tularensis LVS total RNA. Size markers are present on the left side of panel B.
- FIG. 5.
Construction and characterization of figA mutants. (A) Schematic of PCRs used to amplify and sew flanking regions of the F. tularensis LVS figA gene. The promoterless kan cartridge was ligated into this cloned PCR product at the KpnI site. (B) PCR products obtained from the chromosomal DNAs of wild-type and figA mutant strains with oligonucleotide primers (described in Results) binding 1.5 kb from the 5′ and 3′ ends of the figA gene. Lane 1, wild-type F. tularensis LVS; lane 2, F. tularensis LVS figA::np-kan; lane 3, wild-type F. novicida U112; lane 4, F. novicida U112 figA::np-kan. The positions of 4.0-kb and 5.0-kb size markers are indicated on the left. (C) PCR products obtained from chromosomal DNAs of wild-type and mutant strains with primers binding within the kan cartridge; lanes are the same as in panel B. The position of an 850-bp size marker is shown on the left. (D) Western blot analysis of whole-cell lysates of these wild-type and mutant strains grown in MH−/DF broth. Lanes 1 to 4 contain whole-cell lysates of the same strains as in panel B; lane 5 contains a whole-cell lysate of F. novicida U112 figA::np-kan (pKD107). The primary antibody was mouse FigA antiserum. (E) Western blot analysis of these same lysates with rat polyclonal F. tularensis LVS FopA antiserum (i.e., a loading control).
- FIG. 6.
CAS assay. Wild-type F. tularensis LVS and F. novicida U112 and mutant and complemented mutant strains of both were grown on CAS/CDM− agar plates. (A) Wild-type F. tularensis LVS (sector 1) and F. tularensis LVS figA::np-kan (sector 2) grown for 5 days. (B) Wild-type F. novicida U112 (sector 1), F. novicida U112 figA::np-kan (sector 2), F. novicida U112 figA::np-kan(pKD107) (sector 3), F. novicida U112 figA::np-kan(pFNLTP-CAT) (sector 4), and F. novicida U112 figA::np-kan(pKD108) (sector 5) grown for 24 h.
- FIG. 7.
Extracellular and intracellular growth of wild-type and mutant strains of F. tularensis LVS and F. novicida U112. For extracellular growth (A and B), bacteria were grown in both iron-replete (filled symbols) and iron-restricted (open symbols) media. The wild-type F. tularensis LVS strain (panel A, circles), its figA mutant (A, triangles), the wild-type F. novicida strain (B, circles), and its figA mutant (B, triangles) were grown as described in Materials and Methods. To assess intracellular growth (C and D), these same strains were grown in the macrophage cell line J774A.1 as described in Materials and Methods. (C) Wild-type F. tularensis LVS (filled columns) and its figA mutant (open columns). (D) Wild-type F. novicida (filled columns) and its figA mutant (open columns). These data are the means from two independent experiments. In panel D, the difference between the F. novicida wild-type and mutant strains was significant only at 24 h postinfection (asterisk; P = 0.0096, Student's t test).
- FIG. 8.
Cross-feeding of the F. novicida figA mutant by the F. novicida U112 wild-type (w.t.) strain. The F. novicida U112 wild-type strain (streak 1) and its figA mutant (streaks 2, 3, and 4) were inoculated onto both CAS/CDM− (A) and CDM+ (B) agar plates and grown for 36 h.
Tables
- TABLE 1.
Bacterial strains and plasmids used in this study
Strain or plasmid Genotype or description Reference or source E. coli strains DH5α Host strain for cloning experiments 34 HB101 Host strain essential for propagating plasmids carrying mutated Francisella genes used for electroporation of Francisella 34 Francisella tularensis strains LVS no. 11 F. tularensis LVS 10 LVS figA::np-kan Mutant of LVS with promoterless kan cartridge inserted in figA gene This study LVS figA::np-kan(pKD107) LVS figA::np-kan containing pKD107 with F. novicida U112 figA gene; expresses FigA protein This study Francisella novicida strains U112 Wild-type strain of F. novicida 26 U112 figA::np-kan Mutant of U112 with promoterless kan cartridge inserted in figA gene This study U112 figA::np-kan(pKD107) U112 figA::np-kan containing pKD107 with F. novicida U112 figA gene; expresses FigA protein This study U112 figA::np-kan(pKD108) U112 figA::np-kan containing pKD108 with F. tularensis LVS figA gene; expresses FigA protein This study U112 figA::np-kan(pFNLTP-CAT) U112 figA::np-kan containing vector pFNLTP-CAT This study Plasmids pACYC184 Broad-host-range cloning vector; Chlorr Tetr New England Biolabs pKD101 pACYC184 with 2.2-kb fragment containing figA flanking regions This study pKD101-np-kan pKD101 with promoterless kan cartridge inserted into KpnI site This study pFNLTP6 Shuttle vector for Francisella; Kanr Ampr 24 pKD105 pFNLTP6 with F. tularensis LVS figA gene inserted into BamHI site This study pKD108 pKD105 with ΔEcat cartridge inserted into XhoI site; this vector backbone containing the ΔEcat cartridge is the same as that of pFNLTP-CAT This study pFNLTP-CAT pFNLTP6 with ΔEcat cartridge inserted in XhoI site; Kanr Ampr Chlorr This study pKD107 pFNLTP-CAT carrying F. novicida U112 figA gene This study - TABLE 2.
F. tularensis LVS genes whose expression was maximally altered by growth under iron-restricted conditionsa
F. tularensis Schu4 ORF no. Gene identity or function Avg fold differenceb Genes up-regulated under iron-restricted growth conditions 29c Hypothetical protein (FigA) 19.70 27c Diaminopimelate decarboxylase (FigC) 15.13 26c Hypothetical protein (FigD) 14.78 28c Hypothetical protein (FigB) 9.78 1565c Glycosyl hydrolase, family 3, pseudogene 4.08 1702 Conserved hypothetical protein 3.87 1701 Hypothetical protein 3.62 1707 Conserved hypothetical protein 3.41 1542c Outer membrane protein 3.29 1714c Intracellular growth locus, subunit A (IglA) 3.26 383 Hypothetical protein 3.22 989 Hypothetical protein 3.19 1709 Conserved hypothetical protein 3.09 980 Aminotransferase, class II 3.08 1711c Intracellular growth locus, subunit D (IglD) 3.06 1703 Conserved hypothetical protein 3.01 1700 Conserved hypothetical protein (PdpB) 2.99 1706 Conserved hypothetical protein 2.99 1717 Major facilitator superfamily transport protein 2.98 1712c Intracellular growth locus, subunit C (IglC) 2.96 Genes down-regulated under iron-restricted growth conditions 1214c Haloacid dehalogenase-like hydrolase family protein 0.32 881c Amino acid permease 0.39 265 ABC transporter, membrane protein 0.42 1269c Chaperone protein, DnaK (heat shock protein family 70) 0.43 1696 Chaperone protein, GroEL 0.43 1624c Hypothetical protein 0.44 1695 Chaperone protein GroES 0.44 938 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase 0.46 331 30S ribosomal protein S3 0.47 172 Hypothetical membrane protein, fragment 0.48 327 50S ribosomal protein L23 0.49 413c 1,4-α-Glucan branching enzyme 0.49 328 50S ribosomal protein L2 0.49 140 50S ribosomal protein L11 0.50 326 50S ribosomal protein L4 0.50 1048c Hypothetical protein 0.51 266 ABC transporter, ATP-binding protein 0.51 551 Conserved hypothetical protein, pseudogene 0.52 999c ZIP metal transporter family protein, pseudogene 0.52 339 30S ribosomal protein S8 0.52 - TABLE 3.
qRT-PCR analysis of gene expressiona
Schu4 ORF no. Putative function Fold differenceb qRT-PCR primer pair (5′-3′)d Microarray qRT-PCR 26c Hypothetical protein (FigD) 14.8 13.4 F: AAGCCTAATGGTAGCTGGTGAATC R: TTTTGGTGAGACTCCGTAAGTTTTT 29c Hypothetical protein (FigA) 19.7 24.7 F: GGCTACTAAAGACAAAACACTAATGCC R: CAGACTCAGGCGATACTGTTCTTG 27c Diaminopimelate decarboxylase (FigC) 15.1 13.0 F: GGTTTAGCAGGAATAAGCCCTACTC R: TTGTCGCGGCATATAGTTCTAAATC 28c Hypothetical protein (FigB) 9.9 19.1 F: GAGTTTTTTAGCTCAGACCCGATAATC R: ATCGGCGCTGAAAATAGCA 651c Proton-dependent oligopeptide family protein 2.4 0.6 F: CTCGCAAAAAAGACATTAGTATAAAATTAAAT R: AAGTTGCAAATTGTCCCCAAA 1712c Intracellular growth locus, subunit c (IglC) 3.0 2.6 F: AAAAAGGAGAATGATTATGAGTGAGATG R: TGCAGTAGGATCAGTTCTCACATG 403 Peptide deformylase 2.8 3.2 F: CAGCTATAATATTTCAGCATGAATTTAATCA R: AGCAAATTTAGCTTGTAGTTCTTCGTT 1699 Conserved hypothetical protein (PdpA) 2.6 2.6 F: TGAGTTAATTTCAAACTCTGCCATATC R: GTTTGGGTATATGCCATTTCACAG 1780 Putative transposase 1.5 1.1 F: AAGAACCGGAGATTATAGTTCAAAGC R: AAATACTGTTCAATCAATGTTTTATCGG 651c Proton-dependent oligopeptide family protein 1.3 0.7 F: CGTTGATAGTAAAACTATTGGTTTTGCA R: GGAAGAGCAACCACTTGATTTAATAGA 664c Histidine decarboxylase 1.0 1.1 F: CATTTGATGGTGCTTTTCTACCG R: ATATTCCTGAAGGCATCGGATTAC 583 Outer membrane-associated protein 0.9 1.0 F: CAAATCTAGCAGGTCAAGCAACAG R: AACACTTGCTTGAACATTTCTAGATAGTTC 700 Conserved hypothetical protein 0.8 0.6 F: AAAATGGTGTTCGCCTTTTGG R: CCTTCGACATCATCTTTGTAGTCAAC 445 ABC transporter, ATP-binding, pseudogene 0.9 1.2 F: TTAGAAGAGTTTGTTGGAGGATATGATG R: ATTTTTCGACAACTCACTGTTATTTTTAGT 881c Amino acid permease 0.4 0.6 F: CCAAGGTTCAGAAATTATCGGACTA R: GTGCTTAGCGATTCTTGGCAT 50 Translation initiation factor IF2 0.6 0.8 F: TTGGCGCGTATTCTGTTAAGAC R: GCTCGCATTGAAGTAAAAGCCT 140 50S ribosomal protein L11 0.5 0.8 F: ACGCCACCTGCTTCTTACTTAATT R: CGCACGAGTTATAGTTCCAACAA 350 DNA-directed RNA polymerase, alpha subunit 0.7 0.7 F: TTGACAAACCAAAGAGCATTTAGC R: TCTCAAGCTCGGTTGGTATCG 1695 Chaperone protein, GroES 0.4 0.5 F: GCTCAAGAGAAACCTAGCCAAGG R: ACATCCATAGGTAGCGTAGTGCC 326 50S ribosomal protein L4 0.5 0.7 F: AGTTTCTGGTGGCGGTGC R: GGTGAACGGATAGTACCCGCT 1696 Chaperone protein, GroEL 0.4 0.7 F: TTCAAAGACAGCGGATGTTGC R: GCGACAGCTTTTAGACCCTCTG ↵a qRT-PCR for each gene was performed with two individually prepared RNA samples, each in triplicate.
↵b The fold difference indicates the gene expression level under iron-restricted conditions relative to that obtained under iron-replete conditions.
↵c ORF 651 in the F. tularensis Schu4 genome was found to be fragmented into two separate ORFs in the F. tularensis LVS genome by the deletion of a single nucleotide.
↵d F, forward; R, reverse.
HTML Page - index.htslp
Files in this Data Supplement:
- Supplemental file 1
-
Table S1. DNA microarray results.
Zipped Excel document, 190K.
- Supplemental file 1
-
Table S1. DNA microarray results.
