Article Figures & Data
Figures
- FIG. 1.
Functional categories of genes down-regulated in a yfgL::aphT mutant of S. enterica serovar Enteritidis under SPI-1-inducing conditions. Strains were cultured under conditions favorable for SPI-1 gene transcription. After statistical analysis of the microarrays, genes differently expressed in the LA5yfgL::aphT mutant compared to the wild-type strain were grouped into functional categories based on the S. enterica serovar Typhi genome annotation (http://www.sanger.ac.uk/Projects/S_typhi/St_gene_list_hierarchical.shtml ) (P < 0.05). The histogram shows the percentage of genes affected in each category.
- FIG. 2.
SPI-1- and flagellum-related genes down-regulated in a yfgL::aphT mutant of S. enterica serovar Enteritidis. SPI1 (A)- and flagellum (B)-related genes which were found to be repressed in the LA5yfgL::aphT mutant compared to the wild-type strain after culture under conditions favorable for SPI-1 gene transcription are represented. These genes were considered significant when we admitted 11.64% of false-positive genes after statistical analysis. Relative expression corresponds to the ratio of wild-type to mutant gene expression.
- FIG. 3.
Effect of yfgL deletion on the invasion process of S. enterica serovar Enteritidis. (A) The percentage of intracellular bacteria was determined after infection of human HT-29 epithelial cells and gentamicin treatment. Cells were infected with the S. enterica serovar Enteritidis wild-type strain LA5, the LA5ΔyfgL mutant, or the LA5ΔyfgL mutant complemented with pACyfgL for 1 h (multiplicity of infection = 30). Results correspond to the means of three independent experiments carried out in duplicate. Statistical significance was calculated using one-way analysis of variance. Values were compared using the Student-Newman-Keuls test. ***, P < 0.001 for LA5 versus ΔyfgL mutant and for ΔyfgL mutant versus ΔyfgL mutant plus pACyfgL. (B and C) Protein secretion by S. enterica serovar Enteritidis wild-type strain LA5, the LA5ΔyfgL mutant, and the LA5ΔyfgL mutant complemented with pACyfgL grown in LB supplemented with 0.3 M NaCl. Proteins from culture supernatants were precipitated with trichloroacetic acid, separated by 10% SDS-PAGE, and stained with Coomassie brilliant blue (B) or transferred to a nitrocellulose membrane and probed with polyclonal antibodies raised against either SipA (C) or H:g,m flagellin (D). Proteins were revealed using peroxidase-labeled goat anti-rabbit antibody and the Uptilight enhanced chemiluminescence substrate.
- FIG. 4.
Functional categories of genes affected by YfgL under SPI-2-inducing conditions. Strains were cultured under conditions favorable for SPI-2 gene transcription (LPM, pH 5.8). After statistical analysis of the microarrays, genes differentially expressed in the LA5ΔyfgL mutant compared to the wild-type strain were grouped into functional categories based on the S. enterica serovar Typhi genome annotation (http://www.sanger.ac.uk/Projects/S_typhi/St_gene_list_hierarchical.shtml ). The histogram shows the percentage of genes affected in each category.
- FIG. 5.
SPI-2 genes affected by YfgL under SPI-2-inducing conditions. SPI-2 genes which were found to be significantly repressed in the LA5ΔyfgL mutant compared to the wild-type strain after culture under conditions favorable for SPI-2 gene transcription (LPM, pH 5.8) are represented. Relative expression corresponds to the ratio of wild-type to mutant gene expression.
- FIG. 6.
Effect of yfgL deletion on S. enterica serovar Enteritidis virulence in mice. Groups of 10 6-week-old BALB/C mice were orally inoculated with about 5 × 108 CFU of the S. enterica serovar Enteritidis wild-type strain LA5, the LA5ΔyfgL mutant, or the LA5ΔyfgL mutant harboring the plasmid pACyfgL. (A) Spleen colonization at 6 days postinoculation. Results were compared by analysis of variance and analyzed by the Bonferroni-Dunn test. ***, P < 0.001 for LA5 versus the ΔyfgL mutant and for the ΔyfgL mutant versus the ΔyfgL mutant plus pACyfgL. (B) Kinetics of mouse survival over time. Results were compared by analysis of variance and analyzed by the Student t test (P < 0.05). Results of three independent experiments are shown for panels A and B.
- FIG. 7.
Effect of yfgL deletion on outer membrane protein level of S. enterica serovar Enteritidis. Total membrane protein profiles of S. enterica serovar Enteritidis wild-type strain LA5 and the LA5ΔyfgL mutant grown in LB broth supplemented with 0.3 M NaCl or in LPM at pH 5.8 were analyzed. Membrane proteins were obtained as described in Materials and Methods, analyzed by 12% SDS-PAGE, and stained with Coomassie brilliant blue. The positions of FliC, OmpC/F, and OmpA are indicated.
- FIG. 8.
Effect of hilA overexpression in a ΔyfgL mutant of S. enterica serovar Enteritidis. Protein secretion by S. enterica serovar Enteritidis wild-type (WT) strain 1009, the 1009ΔyfgL mutant, the 1009ΔyfgL mutant complemented with pAChilA, and the ΔyfgL invA::aphT mutant complemented with pAChilA grown in LB supplemented with 0.3 M NaCl was analyzed. (A) Proteins from culture supernatants were precipitated with trichloroacetic acid. Intracellular proteins (B) were extracted directly with Laemmli sample buffer. Proteins were separated using 10% SDS-PAGE, transferred to a nitrocellulose membrane, probed with polyclonal antibodies raised against SipA, and finally revealed with peroxidase-labeled goat anti-rabbit antibody and the Uptilight enhanced chemiluminescence substrate.
Tables
- TABLE 1.
Bacterial strains and plasmids used for this study
Strain or plasmid Relevant characteristic(s) Source or reference Strains 1009 S. enterica serovar Enteritidis wild-type strain (Nalr Smr); avirulent in mouse model 17 LA5 S. enterica serovar Enteritidis wild-type strain (Nalr); virulent in mouse model 1 LK5hsdR hsdR mutant of S. enterica serovar Enteritidis LK5 (Spr) 18 EE631 S. enterica serovar Typhimurium EE251 with a sipC::lacZY fusion (11-6) 5 1009sipC::lacZY 1009 with a sipC::lacZY fusion (11-6) This work 1009yfgL::aphT aphT insertion into yfgL of strain 1009 3 LA5 yfgL::aphT aphT insertion into yfgL of strain LA5 This work LA5ΔyfgL LA5 isogenic mutant with the yfgL gene deleted This work 1009ΔyfgL 1009 isogenic mutant with the yfgL gene deleted This work 1009invA::aphΔT aphΔT insertion into invA of strain 1009 This work 1009ΔyfgL invA::aphΔT aphΔT insertion into invA of strain 1009ΔyfgL This work Plasmids pKD4 Vector carrying an FRT-Km-FRT cassette (Cbr Kmr) 14 pKD46 Carries λ-Red γ, β, and exo genes under the control of ParaB; temperature-sensitive replication (Cbr) 14 pCP20 Temperature-sensitive replication and expression of FLP recombinase gene (Cbr) 8 pACYC177 Cloning vector (Cbr Kmr) 7 pUC4K Source of aphT cassette Pharmacia pUC18aphΔT Source of aphΔT cassette 53 pSyfg-eng Plasmid pSU2718 carrying yfgM, yfgL, engA, and yfgJ ORFs 3 pACyfgL 1.7-kb fragment carrying yfgL in plasmid pACYC177 This work pAChilA 2-kb fragment carrying hilA in plasmid pACYC177 This work - TABLE 2.
Primers used in this study
Primer name Sequence (5′ to 3′)a yfgL-P1 CCATTACCGCAGGTTGAAAACCAGTTTACCCCGACCA CTGTCTGGAGCACGTGTAGGCTGGAGCTGCTTC yfgL-P2 CAAAACGCCCGTCATCGACATTAATCCAGTGCAGATA ACCTTCGCTAT CGCATATGAATATCCTCCTTAG yfgL-E GCGAATTCCAGGAAAACGGCCCCTACACCAGGAGC yfgL-S ATCGAGCTCCAATTGCGTAAATTACTTCTGCCAGGG yfgM8 AAGCCGATATCCAGTTGCAGCAGG yfgK12 TGCGGGTCAGAAGCTTAAATAGCGTGG tufA-F TGTTCCGCAAACTGCTGGACG tufA-R ATGGTGCCCGGCTTAGCCAGTA sipA-F CCAACGCAATGGCGAGTCAC sipA-R GCCGTCTCCGTTTGATGCGT fliD-F TCACCACCAAAATTGCCACC fliD-R CCTTGTAACGGGCAACGGT invF-F TTTGCGAGCAGGCCGTTGTC invF-R GCGCCATCGATAAATGCCAGT hilA-F GGTTTAATCGTCCGGTCGTAGTG hilA-R CCTGATCCTGCATCTGAAAAGG hilA1-C GCACTATCGATACCAGGATATACGGCAGCGTCCAT hilA2-S GCACTCCCGGGCTAAGCAACCAGATTACGATGATA sseA-F TTCACCAAATCCGGGCTA sseA-R TCTCGGCCTCCTGGTTAA ssrB-F CTTAGTCTACCTGGCATCAATGGC ssrB-R CGCTAACAGAACTTGCTGACTACTGC ↵ a Restriction sites are underlined.
- TABLE 3.
Effect of yfgL deletion on transcription of genes involved in invasion, motility, and intracellular survival of S. enterica serovar Enteritidis
Strain Log10 cDNA copy no. of target gene (mean ± SEM)a sipAb invFb hilAb fliDb sseAc ssrBc LA5 8.33 ± 0.21 7.86 ± 0.08 6.89 ± 0.08 7.77 ± 0.30 6.41 ± 0.06 7.79 ± 0.24 LA5yfgL::aphT 7.12 ± 0.10 6.68 ± 0.08 5.95 ± 0.21 6.33 ± 0.22 ND ND LA5yfgL::aphT(pSyfg-eng) 7.56 ± 0.17 7.46 ± 0.13 6.26 ± 0.3 7.17 ± 0.27 ND ND LA5ΔyfgL 6.53 ± 0.22 ND 5.63 ± 0.20 6.37 ± 0.08 5.10 ± 0.25 6.97 ± 0.33 LA5ΔyfgL(pACyfgL) 8.04 ± 0.14 ND 6.89 ± 0.11 7.09 ± 0.09 6.03 ± 0.17 7.56 ± 0.29 ↵ a The mRNA expression of sipA, invF, hilA, fliD, sseA, and ssrB was assessed by real-time RT-PCR. The expression levels of the indicated genes were normalized to the expression level of the housekeeping gene tufA. The results correspond to the means for at least three independent RNA extractions quantified in duplicate. ND, not done.
↵ b Expression of the gene was analyzed from bacteria cultured in LB containing 0.3 M NaCl, corresponding to conditions allowing SPI-1 gene expression induction.
↵ c Expression of the gene was analyzed from bacteria cultured in LPM, pH 5.8, corresponding to conditions allowing SPI-2 gene expression induction.
- TABLE 4.
Effect of yfgL deletion on antibiotic sensitivity of S. enterica serovar Enteritidis
Strain Inhibition zone (mm)a Van Bac Ery Rif Nov LA5 ND ND 8 11 ND LA5ΔyfgL 13 9 14 21 ND ↵ a Sensitivity to vancomycin (Van), bacitracin (Bac), erythromycin (Ery), rifampin (Rif), and novobiocin (Nov) was determined by a disk diffusion assay. Readings were performed after an incubation time of 20 h. ND, no detectable zone of growth inhibition.
Supplemental material
Files in this Data Supplement:
- Supplemental file 1
-
Table S1. Microarray statistical analysis: wild-type LA5 vs. yfgL::aphT in SPI-1-inducible conditions (LB NaCl 0.3 M).
Zipped Excel files, 12K. - Supplemental file 2
-
Table S2. Microarray statistical analysis: wild-type LA5 vs. δyfgL in SPI-2-inducible conditions (LPM) (significantly overexpressed genes in the δyfgL strain).
Zipped Excel files, 25K. - Supplemental file 3
-
Table S3. Microarray statistical analysis: wild-type LA5 vs. δyfgL in SPI-2-inducible conditions (LPM) (significantly repressed genes in the δyfgL mutant).
Zipped Excel files, 12K.
- Supplemental file 1
-
Table S1. Microarray statistical analysis: wild-type LA5 vs. yfgL::aphT in SPI-1-inducible conditions (LB NaCl 0.3 M).
