The Rab6 Effector Bicaudal D1 Associates with Chlamydia trachomatis Inclusions in a Biovar-Specific Manner

Cell culture and organisms.Monolayer cultures of HeLa 229 epithelial cells (CCL-1.2; American Type Culture Collection [ATCC], Manassas, VA) were grown in RPMI 1640 (Mediatech, Inc., Herndon, VA) supplemented with 10% fetal bovine serum (FBS; Atlas Biologicals, Fort Collins, CO) and 10 μg/ml of gentamicin (Invitrogen, Carlsbad, CA) at 37°C in an atmosphere of 5% CO₂ and 95% humidified air. Chlamydia trachomatis lymphogranuloma venereum (LGV) 434 (serotype L2), TW/5OT (serotype B), and UW-3/CX (serotype D), Chlamydia muridarum, and C. pneumoniae (AR-39) were propagated in HeLa cells and purified by renografin density centrifugation (7). Infections were carried out as described previously (40).

Antibodies.Mouse antichlamydial lipopolysaccharide (LPS) was generously provided by Harlan Caldwell (Rocky Mountain Laboratories, National Institutes of Allergy and Infectious Diseases [NIAID], and National Institutes of Health [NIH]), and rabbit anti-C. trachomatis EB antiserum was prepared as previously described (48). Additional antibodies used were as follows: mouse anti-GM130 (BD Transduction Laboratories, San Jose, CA), goat anti-mouse immunoglobulin G (IgG) conjugated to fluorescein isothiocyanate or Texas Red and goat anti-rabbit IgG conjugated to Texas Red (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), and goat anti-mouse and anti-rabbit IgG conjugated to Cy5 (Zymed Laboratories, Inc., South San Francisco, CA).

Plasmid constructions.Enhanced green fluorescent protein (EGFP)-Rab6 nucleotide-binding mutants were constructed by site-directed mutagenesis (QuikChange; Stratagene, La Jolla, CA) using EGFP-Rab6A (40) as a template. EGFP-Rab6A(Q72L) was constructed using the 5′ mutagenic oligonucleotide GGGACACAGCAGGTCTAGAGCGGTTCAGGAGC and the 3′ mutagenic oligonucleotide GCTCCTGAACCGCTCTAGACCTGCTGTGTCCC; EGFP-Rab6A(T27N) was constructed using the 5′ mutagenic oligonucleotide CAAAGCGTTGGAAAGAACTCTTTGATCACCAGATTC and the 3′ mutagenic oligonucleotide GAATCTGGTGATCAAAGAGTTCTTTCCAACGCTTTG; EGFP-Rab6A(I46E) was constructed using the 5′ mutagenic oligonucleotide CCTATCAGGCAACAGAAGGCATTGACTTTTTATC and the 3′ mutagenic oligonucleotide GATAAAAAGTCAATGCCTTCTGTTGCCTGATAGG; and EGFP-Rab6AN126I was constructed using the 5′ mutagenic oligonucleotide CATCATGCTAGTAGGAATTAAAACAGATCTTGCTG and the 3′ mutagenic oligonucleotide CAGCAAGATCTGTTTTAATTCCTACTAGCATGATG. EGFP-BICD1 was constructed by PCR amplification using a 5′ gene-specific primer designed with a 5′ BamHI site (GGATCCATATGGCCGCAGAAGAGGTATTGC) and a 3′ gene-specific primer designed with a 5′ SalI site (GTCGACCTAGGGGTGAGGAGGCTTGGAG) using a HeLa cDNA library (Clontech, Palo Alto, CA) as a template. EGFP-BICD1-CC1(1-276) and EGFP-BICD1-CC1/CC2(1-630) were constructed by PCR amplification using the same 5′ gene-specific primer as EGFP-BICD1 and the 3′ gene-specific primers with a 5′ SalI site (GTCGACCTACCCATCCTCGGCAAATTTGAGTCC and GTCGACCTAGGCATTAAGGTTGTAGATATTCATTGG, respectively). EGFP-BICD1-CC3(630-975*) was similarly constructed using a 5′ gene-specific primer designed with a 5′ BamHI site (GGATCCATATAATCCGGGACCAAATCAAGC) and the same 3′ oligonucleotide that was used for EGFP-BICD1. After cloning the PCR products into pGEM-T Easy (Promega, Madison, WI), the BamHI/SalI fragments containing the BICD1 coding regions were cloned into the BglII/SalI sites of pEGFP-C2 (Clontech). Upon DNA sequencing, it was determined that amino acids 821 to 920 were deleted from this construct, and the construct is designated 630-975* to indicate this deletion. The same deletion was found in EGFP-BICD1. DsRed-BICD1-CC1(1-276) was constructed by PCR amplification using a 5′ gene-specific primer with a 5′ BamHI site (GGATCCATGGCCGCAGAAGAGGTATTGC) and the same 3′ gene-specific primer used for EGFP-BICD1-CC1(1-276) using EGFP-BICD1 as a template. DsRed-BICD1-CC3(630-975*) was constructed in a similar fashion using a 5′ gene-specific primer with a BamHI site (GGATCCATAATCCGGGACCAAATCAAGC) and the same 3′ gene-specific primer used for EGFP-BICD1. The PCR products were cloned into pGEM-T Easy, and the BamHI/SalI fragments containing the BICD1 coding regions were isolated and cloned into the BglII/SalI sites of DsRed-Express-C1 (Clontech). All PCR amplifications were performed using HiFidelity Platinum Taq polymerase (Invitrogen), and each fusion construct was confirmed by DNA sequencing (BioResource Center, Cornell University, Ithaca, NY).

Eukaryotic cell transfection and infection.HeLa 229 cells were grown on 12-mm-diameter glass coverslips (no. 1 thickness) in 24-well plates (Corning Inc., Corning, NY) at 37°C in an atmosphere of 5% CO₂ and 95% humidified air. Cells were washed once in serum-free RPMI 1640 and transfected with Lipofectamine (Invitrogen) using a total of 0.4 μg of DNA per well according to the manufacturer's protocol (Invitrogen). For C. trachomatis serovar L2 infections, 24 h posttransfection, the cells were infected at a multiplicity of infection of approximately 1 or 20 and incubated for the indicated times in RPMI 1640 supplemented with 10% FBS and 10 μg/ml of gentamicin at 37°C in an atmosphere of 5% CO₂ and 95% humidified air. For C. trachomatis serovars B and D, C. muridarum, and C. pneumoniae, the chlamydial inoculum was centrifuged onto transfected HeLa cell monolayers for 1 h at 20°C at 900 × g, and cycloheximide was added to growth media at a final concentration of 1 μg/ml. Cells were infected for 18 h, except for C. pneumoniae infections, which were allowed to proceed for 44 h.

Nocodazole, chloramphenicol, and BFA treatment of cells.Cells were transfected as described above. For experiments requiring pretreatment with nocodazole (Calbiochem, San Diego, CA) or brefeldin A (BFA; EMD Biosciences, San Diego, CA), cells were incubated in RPMI 1640 supplemented with 10% FBS, 10 μg/ml of gentamicin, and 20 μM nocodazole or 1 μg/ml BFA for 3 h prior to infection. Cells were infected as described above and incubated in RPMI 1640 supplemented with 10% FBS, 10 μg/ml of gentamicin, and 20 μM nocodazole or 1 μg/ml BFA for the indicated times before fixation. For experiments in which cells were treated with nocodazole postinfection, RPMI 1640 supplemented with 10% FBS, 10 μg/ml of gentamicin, and 20 μM nocodazole was added to the cells for 4 h prior to fixation. For chloramphenicol-treated cells, cells were infected for 12 h in the presence of 200 μg/ml chloramphenicol (EM Science, Gibbstown, NJ). Cells were then fixed in 4% formaldehyde in phosphate-buffered saline (PBS) and labeled with antibodies as described below.

LSCM.Cells were fixed in 4% formaldehyde in PBS for 60 min (antichlamydial LPS) or in ice-cold methanol for 10 min at room temperature (RT) (anti-GM130, antichlamydial EB antiserum). For antibody labeling of formaldehyde-fixed cells, cells were permeabilized in PBS containing 0.05% saponin and 0.2% bovine serum albumin for 10 min at RT, and primary and secondary antibodies were incubated in permeabilization buffer sequentially for 60 min each at RT. For antibody labeling of methanol-fixed cells, cells were blocked in PBS containing 3.0% bovine serum albumin for 10 min at RT, and primary and secondary antibodies were incubated in blocking buffer sequentially for 60 min each at RT. Coverslips were mounted onto glass slides using Prolong Antifade (Molecular Probes, Eugene, OR) and viewed by laser scanning confocal microscopy (LSCM). An Olympus Fluoview 500 confocal laser scanning imaging system equipped with argon, krypton, and He-Ne lasers on an Olympus IX70 inverted microscope with a PLAPO 60× objective was used (Olympus America, Inc., Melville, NY). Confocal images were processed using Adobe Photoshop 6.0 (Adobe Systems, Inc., Mountain View, CA).

EGFP-Rab6 localizes to C. trachomatis serovar L2 inclusions in a guanine nucleotide-dependent fashion.We have recently shown that Rab6 isoforms are recruited to chlamydial inclusions in a species-specific fashion (40). Rab GTPases function through interactions with specific downstream effector molecules when bound to GTP but not when bound to GDP (35, 37). Therefore, to determine whether Rab6 interacts with C. trachomatis serovar L2 inclusions in a similar guanine nucleotide-dependent manner, we examined the intracellular localization of both GTP- and GDP-restricted EGFP-Rab6 mutants in C. trachomatis serovar L2-infected HeLa cells. HeLa cells were transiently transfected with wild-type EGFP-Rab6A, constitutively active GTPase-deficient EGFP-Rab6A(Q72L), and dominant negative GDP-restricted EGFP-Rab6A(T27N) for 24 h. Transfected cells were then infected with C. trachomatis serovar L2 EBs or mock infected. At 18 h postinfection, cells were fixed and stained with antichlamydial LPS antiserum and examined by LSCM. As has been previously reported, in uninfected cells, EGFP-Rab6A(Q72L) localized to the Golgi apparatus, whereas EGFP-Rab6A(T27N) was dispersed in the cytoplasm (26, 27, 59). As shown in Fig. 1, EGFP-Rab6A (A) and EGFP-Rab6A(Q72L) (B) localized to C. trachomatis serovar L2 inclusions, as demonstrated by the distinct rim-like staining pattern surrounding the inclusion. In contrast, EGFP-Rab6A(T27N) (Fig. 1C) did not localize to inclusions, as demonstrated by the absence of staining at the periphery of the inclusion. These data demonstrate that EGFP-Rab6A is recruited to the chlamydial inclusion in a guanine nucleotide-dependent fashion. This conclusion is further supported by the observation that neither EGFP-Rab6A(I46E), which is unable to bind effectors (12, 59), nor EGFP-Rab6A(N126I), which is unable to bind nucleotides (12, 28), is recruited to the chlamydial inclusion (Fig. 1D and E). In addition, EGFP-Rab6A′ was recruited in a similar guanine nucleotide-dependent manner (data not shown). Taken together, these data demonstrate that only active GTP-bound Rab6 is localized to inclusions and suggest that Rab6 is recruited via either a host effector protein or a chlamydial protein mimicking a Rab6 effector.

• Open in new tab
• Download powerpoint

FIG. 1.

EGFP-Rab6A localizes to C. trachomatis serovar L2 inclusions in a guanine nucleotide-dependent fashion. HeLa cells transiently transfected with EGFP-Rab6A (A), EGFP-Rab6A(Q72L) (B), EGFP-Rab6A(T27N) (C), EGFP-Rab6A(I46E) (D), or EGFP-Rab6A(N126I) (E) were infected with C. trachomatis serovar L2 EBs for 18 h. Cells were then fixed and stained with antichlamydial LPS (data not shown) and examined by LSCM. Both EGFP-Rab6A (A) and EGFP-Rab6A(Q72L) (B) were recruited to inclusions, as demonstrated by the distinct rim-like staining pattern. In contrast, EGFP-Rab6A(T27N) (C), EGFP-Rab6A(I46E) (D), and EGFP-Rab6A(N126I) (E) were not recruited. Arrows indicate inclusions. The asterisk indicates an untransfected infected cell. Bar, 10 μm.

BICD1, a Rab6 effector, is recruited to chlamydial inclusions.Since Rab GTPases function through their interaction with their respective downstream effectors, if Rab6 functions at the inclusion, then host Rab6 effectors may also be recruited. To address this question, we examined whether BICD1, a known Rab6 effector that has been shown to interact with both Rab6 and dynein (27, 49), was also recruited to C. trachomatis inclusions. BICD1 is an α-helical coiled-coil protein that is a human orthologue of the Drosophila melanogaster protein Bic-D, which is essential for oocyte development and microtubule organization during oogenesis (22, 24, 52, 53). In order to determine whether BICD1 localized to the inclusion, we examined the intracellular localization of EGFP-BICD1 in uninfected or infected HeLa cells. HeLa cells transiently expressing EGFP-BICD1 were infected with C. trachomatis serovar L2 for 18 h or mock infected. Cells were fixed and stained with antichlamydial LPS (data not shown) and viewed by LSCM. Similar to endogenous BICD1 (27), EGFP-BICD1 localized to the Golgi apparatus in uninfected cells (data not shown). As shown in Fig. 2A, EGFP-BICD1 is recruited to the serovar L2 inclusion, as demonstrated by the distinct rim-like immunofluorescence staining surrounding the inclusion. EGFP-BICD2 was also recruited to the serovar L2 inclusion (data not shown).

• Open in new tab
• Download powerpoint

FIG. 2.

EGFP-BICD1 localizes to the C. trachomatis serovar L2 inclusion. HeLa cells transiently expressing EGFP-BICD1 (A), EGFP-BICD1-CC1(1-276) (B), EGFP-BICD1-CC1/2(1-630) (C), or EGFP-BICD1-CC3(630-975*) (D) were infected with C. trachomatis serovar L2 for 18 h and then fixed and stained with antichlamydial LPS (data not shown). Cells were examined by LSCM. EGFP-BICD1 (A) and EGFP-BICD1-CC3(630-975*) (D) were recruited to C. trachomatis serovar L2 inclusions, as demonstrated by the distinct rim-like staining pattern surrounding the chlamydial inclusion, whereas EGFP-BICD1-CC1(1-276) (B) and EGFP-CC1/CC2(1-630) (C) were not recruited. Arrows indicate inclusions. Bar, 10 μm.

Recruitment of BICD1 to chlamydial inclusions is mediated by the carboxy-terminal domain of BICD1.Three coiled-coil domains are present in BICD1 (Fig. 3). The amino-terminal coiled-coil domain (CC1) of BICD1 encoded by amino acids 1 to 276 has been shown to interact with dynein, whereas the carboxy-terminal coiled-coil domain (CC3) of BICD1 encoded by amino acids 630 to 820 has been shown to be required for the Golgi localization of BICD1 through its interaction with Rab6 (22, 27, 49). In order to further characterize the association of BICD1 with the inclusion, EGFP fusion proteins containing amino acids 1 to 276, EGFP-BICD1-CC1(1-276), amino acids 1 to 630, EGFP-BICD1-CC1/CC2(1-630), or amino acids 630 to 975, EGFP-BICD1-CC3(630-975*), were constructed and transiently expressed in HeLa cells. Transiently transfected HeLa cells were infected with C. trachomatis serovar L2 or mock infected. At 18 h postinfection, cells were fixed and viewed by LSCM. Consistent with previously published data, in uninfected cells, EGFP-BICD1-CC3(630-975*) colocalized with the Golgi marker GM130, while EGFP-BICD1-CC1(1-276) and EGFP-CC1/CC2(1-630) were localized to the cytosol (22; data not shown). In addition, the expression of EGFP-BICD1-CC1(1-276) and EGFP-BICD1-CC1(1-630) inhibited dynein/dynactin-dependent trafficking pathways, resulting in the cytosolic dispersal of Golgi vesicles (22; data not shown). In C. trachomatis serovar L2-infected cells, EGFP-BICD1-CC3(630-975*) (Fig. 2D), but not EGFP-BICD1-CC1(1-276) (Fig. 2B) or EGFP-BICD1-CC1/CC2(1-630) (Fig. 2C), was recruited to the inclusion. Thus, the domain encoded by amino acids 630 to 975*, which mediates the recruitment of BICD1 to the inclusion, encompasses the amino acids (amino acids 673 to 803) that mediate the interaction of BICD1 with Rab6 (26) (Fig. 3).

• Open in new tab
• Download powerpoint

FIG. 3.

Schematic of BICD1 fusion proteins used in this study. BICD1 contains three coiled-coil domains (CC1, CC2, and CC3) (black rectangles) encoded by amino acids 1 to 265, 319 to 496, and 663 to 803, respectively. The CC1 domain of BICD1, encoded by amino acids 1 to 265, has been shown to interact with dynein (22), while amino acids 673 to 803, which are contained within CC3, have been shown to interact with Rab6 (49), as indicated by the white rectangles. The full-length BICD1 and fusions containing the CC3 domain utilized in this study are deleted for amino acids 821 to 920, possibly due to PCR amplification of a previously unreported splice variant of BICD1. EGFP and DsRed-Express amino-terminal fusions containing the indicated amino acids of BICD1 were constructed and expressed in HeLa cells infected with C. trachomatis serovars L2, D, and B, C. muridarum, or C. pneumoniae (Cpn). Localization to each inclusion was determined by LSCM. + indicates localization to the inclusion, as demonstrated by a rim-like fluorescence staining pattern at the inclusion membrane; − indicates the absence of localization to the inclusion.

EGFP-BICD1 is recruited to chlamydial inclusions in a biovar-specific manner.We have previously demonstrated that Rab6 is recruited to C. trachomatis inclusions in a species-specific manner (40). To further characterize the association of BICD1 with chlamydial inclusions, we wished to determine whether BICD1 was recruited to inclusions in a species-specific manner similarly to Rab6. Therefore, we analyzed the intracellular localization of EGFP-BICD1 in HeLa cells infected with C. trachomatis serovar B (an oculotropic serovar), C. trachomatis serovar D (a genitotropic serovar), C. muridarum, or C. pneumoniae (AR39). As shown in Fig. 4, EGFP-BICD1 was not recruited to the C. trachomatis serovar B (A), C. trachomatis serovar D (B), C. muridarum (C), or C. pneumoniae (D) inclusions. In contrast to Rab6, which is recruited to all C. trachomatis serovars examined (40), EGFP-BICD1 is recruited only to C. trachomatis serovar L2 inclusions. Therefore, although BICD1 is a known effector of Rab6, it displays a different tropism for chlamydial inclusions than does Rab6 (40).

• Open in new tab
• Download powerpoint

FIG. 4.

EGFP-BICD1, but not EGFP-BICD1-CC3, localizes to C. trachomatis inclusions in a biovar-specific manner. HeLa cells transiently expressing EGFP-BICD1 (A to D) or EGFP-BICD1-CC3(630-975*) (E to H) were infected 24 h posttransfection with C. trachomatis (CT) serovar B (A and E), C. trachomatis serovar D (B and F), or C. muridarum (C and G) for 18 h or C. pneumoniae for 44 h (D and H). Cells were fixed, permeabilized, and stained with antichlamydial LPS (data not shown). Cells were viewed by LSCM. EGFP-BICD1 was not recruited to C. trachomatis serovar B (A), C. trachomatis serovar D (B), C. muridarum (C), or C. pneumoniae (D) inclusions. In contrast, EGFP-BICD1-CC3(630-975*) was recruited to C. trachomatis serovar B (E), C. trachomatis serovar D (F), and C. pneumoniae (H) inclusions but not to C. muridarum inclusions (G). Arrows indicate inclusions. Bar, 10 μm.

In order to gain further insight into the C. trachomatis biovar-specific recruitment of BICD1, we examined the recruitment of EGFP-BICD1-CC3(630-975*) to inclusions of the C. trachomatis trachoma biovars, C. muridarum, and C. pneumoniae. Surprisingly, in contrast to what was observed for full-length EGFP-BICD1, EGFP-BICD1-CC3(630-975*) was recruited to C. trachomatis serovar B (Fig. 4E) and serovar D (Fig. 4F) inclusions as well as to C. pneumoniae (AR39) inclusions (Fig. 4H). However, similar to full-length EGFP-BICD1, EGFP-BICD1-CC3(630-975*) was not recruited to the C. muridarum inclusion (Fig. 4G). While the reason for the different patterns of recruitment of full-length BICD1 to chlamydial inclusions versus those for the CC3 domain has not been determined, differences in affinities with the inclusion membrane may play a role.

Intramolecular interactions between the CC1 and the CC3 domains, which have been postulated to regulate the BICD1 association with Rab6 and dynein/dynactin, have been demonstrated using a yeast two-hybrid system (22, 49). In the absence of Rab6-coated vesicles and dynein/dynactin, CC1 is thought to interact with CC3, thus preventing the interaction of proteins with the CC3 domain (22). The autoinhibitory intermolecular interaction between CC1 and CC3 is relieved through the interaction of CC3 with BICD1-interacting proteins such as Rab6 (22). Based upon these observations, we hypothesize that the C. trachomatis serovar L2 inclusion may have a greater affinity for the CC3 domain than the other strains examined and thus is able to promote the “release” of CC3 from CC1, resulting in the recruitment of full-length BICD1 to the inclusion. In contrast, the affinity of the CC3 domain for the other chlamydial inclusions is too weak to promote the dissociation of the intermolecular interactions between CC1 and CC3, and therefore, the CC3 domain present within full-length BICD1 is not accessible to the inclusion. If this hypothesis is correct, the overexpression of both EGFP-BICD1-CC3 and DsRed-BICD1-CC1 in the same cell should prevent the recruitment of EGFP-BICD1-CC3 to the C. trachomatis serovar B and D inclusions as well as to the C. pneumoniae inclusion but not to the serovar L2 inclusion. As predicted, in the presence of DsRed-BICD1-CC1 (1-276), EGFP-BICD1-CC3(630-975*) was not recruited to C. trachomatis serovar B (Fig. 5B), C. trachomatis serovar D (Fig. 5C), or C. pneumoniae (Fig. 5D) inclusions but was still recruited to the C. trachomatis serovar L2 inclusion (Fig. 5A). Interestingly, in the presence of EGFP-BICD1-CC3(630-975*), DsRed-BICD1-CC1(1-276) was now recruited to the serovar L2 inclusion (Fig. 5B), presumably through its interaction with EGFP-BICD1-CC3(630-975*).

• Open in new tab
• Download powerpoint

FIG. 5.

Recruitment of EGFP-BICD1-CC3(630-975*) to the C. trachomatis (CT) serovar B, C. trachomatis serovar D, and C. pneumoniae inclusions, but not to the C. trachomatis serovar L2 inclusion, is inhibited by coexpression of DsRed-BICD1-CC1(1-276). HeLa cells transiently coexpressing EGFP-BICD1-CC3(630-975*) (A to D) and DsRed-BICD1-CC1(1-276) (E to H) were infected 24 h posttransfection with C. trachomatis serovar L2 (A and E), C. trachomatis serovar B (B and F), or C. trachomatis serovar D (C and G) for 18 h or C. pneumoniae for 44 h (D and H). Cells were fixed and viewed by LSCM. Neither EGFP-BICD1-CC3(630-975*) nor DsRed-BICD1-CC1(1-276) was recruited to C. trachomatis serovar B (B and F), C. trachomatis serovar D (C and G), or C. pneumoniae (D and H) inclusions. In contrast, DsRed-BICD1-CC1(1-276) and EGFP-BICD1-CC3(630-975*) were both recruited to C. trachomatis serovar L2 inclusions (A and E). Arrows indicate inclusions. Asterisks indicate aggregates of colocalized EGFP-BICD1-CC3(630-975*) and DsRed-CC1(1-276). Bar, 10 μm.

The association of EGFP-Rab6 and EGFP-BICD1 with the C. trachomatis serovar L2 inclusion is independent of microtubules and the Golgi apparatus but is dependent on early chlamydial gene expression.Although we have demonstrated that EGFP-Rab6 isoforms and EGFP-BICD1 associate with C. trachomatis inclusions (40), the biological roles of each protein during chlamydial infection have not yet been established. In order to begin to understand the function of Rab6 and BICD1 in chlamydial pathogenesis, we wanted to further characterize their recruitment to the C. trachomatis inclusion. Rab6- and BICD1-associated vesicles, as well as C. trachomatis serovar L2-containing vacuoles, are trafficked within the cell in a microtubule-dependent manner (9, 26, 61). Previous data have demonstrated that intact microtubules are not required for the continued association of EGFP-Rab6 with C. trachomatis serovar L2 inclusions (40). To determine whether EGFP-BICD1 associated with the inclusion in a similar manner, we examined the intracellular localization of EGFP-BICD1 in infected cells treated with nocodazole. HeLa cells transiently expressing EGFP-BICD1-CC3(630-975*) and EGFP-BICD1 were infected with C. trachomatis serovar L2 EBs at a multiplicity of infection of approximately 1. Eighteen hours postinfection, cells were treated with nocodazole for 4 h, fixed, and stained with antichlamydial LPS. Prior to the addition of nocodazole, the localization of EGFP-BICD1-CC3(630-975*) and EGFP-BICD1 to the inclusion was confirmed by epifluorescence microscopy (data not shown). In the absence of microtubules, both EGFP-BICD1-CC3(630-975*) and EGFP-BICD1 remained localized to the inclusion (Fig. 6G and K). Therefore, similar to Rab6, the association of BICD1 with the inclusion does not require an intact microtubule network. Since the depolymerization of microtubules causes individual Golgi cisternae to be dispersed throughout the cytosol, these data also confirm that the recruitment of EGFP-BICD1 to the inclusion does not occur simply because the inclusion is situated in close proximity to the Golgi apparatus.

• Open in new tab
• Download powerpoint

FIG. 6.

EGFP-Rab6A and EGFP-BICD1 are recruited to the inclusion by a unique microtubule- and Golgi apparatus-independent mechanism. HeLa cells transiently expressing EGFP-Rab6A (A to C), EGFP-BICD1-CC3(630-975*) (D to G), or EGFP-BICD1 (H to K) were infected with C. trachomatis serovar L2 EBs for 12 h in absence of any treatment (A, D, and H) or in the presence of nocodazole for 12 h (B, E, and I) or were infected for 18 h and then treated with nocodazole for 4 h (G and K). At the indicated times, cells were fixed and stained with antichlamydial LPS and viewed by LSCM. EGFP-Rab6A, EGFP-BICD1-CC3(630-975*), and EGFP-BICD1 were recruited to the inclusion in the absence of microtubules (B, E, and I) and maintained their association with the inclusion when microtubules were dissembled after their recruitment to the inclusion (G and K) (40). HeLa cells transiently expressing EGFP-Rab6A (C), EGFP-BICD-CC3(630-975*) (F), or EGFP-BICD1 (J) were infected with C. trachomatis serovar L2 EBs in the presence of BFA. At 12 h postinfection, cells were fixed and viewed by LSCM. All three EGFP fusion proteins were recruited to the inclusion in the presence of BFA, demonstrating that an intact Golgi apparatus is not required for the trafficking of either Rab6 or BICD1 to the inclusion. Arrows indicate selected inclusions. Bar, 10 μm.

Next, we wanted to determine whether an intact microtubule network was required for the initial recruitment of EGFP-Rab6A, EGFP-BICD1-CC3(630-975*), or EGFP-BICD1 to the inclusion. To address this question, transiently transfected HeLa cells were pretreated with nocodazole for 3 h prior to infection. At 12 h postinfection, cells grown in the continual presence of nocodazole were fixed and stained with antichlamydial LPS. As shown in Fig. 6, when the microtubule network was disassembled prior to chlamydial infection, EGFP-Rab6A (B), EGFP-BICD1-CC3(630-975*) (E), and EGFP-BICD1 (I) still colocalized with cytosolically dispersed inclusions. In support of these data, the recruitment of both EGFP-Rab6 and EGFP-BICD1-CC3(630-975*) to the inclusion was also independent of both dynein and dynactin (data not shown). These data demonstrate that Rab6A and BICD1 are trafficked to the inclusion by a microtubule-independent mechanism, suggesting that they are trafficked to the inclusion by a different mechanism than what is used to traffic these two proteins to the Golgi apparatus in uninfected cells.

Since both Rab6 and BICD1 are normally localized to the Golgi apparatus, we wanted to determine whether an intact Golgi apparatus was required for the localization of either protein to the inclusion. To examine this, HeLa cells transiently expressing EGFP-Rab6A, EGFP-BICD1-CC3(630-975*), or EGFP-BICD1 were pretreated with BFA, a fungal metabolite that causes the collapse of the Golgi apparatus into the ER (45), for 3 h in order to disrupt the Golgi apparatus prior to infection with serovar L2. Twelve hours postinfection, cells grown in the continual presence of BFA were fixed and stained with antichlamydial antiserum to visualize the chlamydiae and anti-GM130 to confirm the breakdown of the Golgi apparatus (data not shown). All three EGFP fusion proteins localized to the inclusion in the presence of BFA, demonstrating that an intact Golgi apparatus is not required for the delivery of either Rab6 or BICD1 to the inclusion (Fig. 6C, F, and J). Finally, the trafficking of EGFP-BICD1 and EGFP-Rab6A to the serovar L2 inclusion was inhibited when infected cells were grown in the presence of chloramphenicol, demonstrating that a chlamydia-derived modification of the inclusion is required for the recruitment of each protein to chlamydia-containing vacuoles (data not shown).

BICD1 is trafficked to the C. trachomatis serovar L2 inclusion by a Rab6-independent mechanism.BICD1 localizes to the Golgi apparatus in a Rab6-dependent fashion (27). To determine whether BICD1 is also trafficked to the inclusion by a Rab6-dependent mechanism, we examined the intracellular localization of DsRed-BICD1-CC3(630-975*) in cells expressing EGFP-Rab6A(T27N). Since Rab6A(T27N) functions as a dominant negative mutant by preventing the activation of endogenous wild-type Rab6 (11, 23, 26), the expression of EGFP-Rab6A(T27N) in infected cells should prevent the localization of endogenous Rab6 to the inclusion. If Rab6A mediates the recruitment of BICD1 to the inclusion, the expression of EGFP-Rab6A(T27N) should prevent the localization of DsRed-BICD1-CC3(630-975*) to the inclusion. However, if the association of DsRed-BICD1-CC3(630-975*) with the inclusion is Rab6 independent, then DsRed-BICD1-CC3(630-975*) should still localize to the inclusion even in the presence of EGFP-Rab6A(T27N). HeLa cells transiently coexpressing DsRed-BICD1-CC3(630-975*) and either EGFP-Rab6A or EGFP-Rab6A(T27N) were mock infected or infected with C. trachomatis serovar L2 EBs. Uninfected cells were then fixed and stained with anti-GM130 antiserum, while infected cells were stained with antichlamydial LPS. As expected, in uninfected cells, DsRed-BICD1-CC3(630-975*) colocalized with the Golgi marker GM130 in the presence of EGFP-Rab6A (Fig. 7E and data not shown) but not EGFP-Rab6A(T27N) (Fig. 7F and data not shown), thus confirming that BICD1 is trafficked to the Golgi apparatus in a Rab6-dependent manner. However, in infected cells, even in the presence of EGFP-Rab6A(T27N), DsRed-BICD1-CC3(630-975*) was still recruited to the inclusion (Fig. 7H). These data demonstrate that BICD1 associates with the inclusion independently of Rab6, which is consistent with the observation that BICD1 does not always colocalize with Rab6 at the inclusion membrane (Fig. 7C and G). In addition, these data also suggest that BICD1 does not require trafficking to the Golgi apparatus prior to delivery to the inclusion.

• Open in new tab
• Download powerpoint

FIG. 7.

DsRed-BICD1-CC3 associates with the inclusion by a Rab6-independent mechanism. HeLa cells transiently coexpressing EGFP-Rab6A and either DsRed-BICD1-CC3(630-975*) (A, C, E, and G) or EGFP-Rab6A(T27N) and DsRed-BICD1-CC3(630-975*) (B, D, F, and H) were mock infected (A, B, E, and F) or infected with C. trachomatis serovar L2 EBs (C, D, G, and H) for 18 h. Cells were fixed and stained with antichlamydial LPS or anti-GM130 antiserum (data not shown) and examined by LSCM. DsRed-BICD1-CC3(630-975*) colocalized with the Golgi apparatus in the presence of EGFP-Rab6A (E) (data not shown) but not in the presence of EGFP-Rab6A(T27N) (F) (data not shown). In infected cells, DsRed-BICD1-CC3(630-975*) localized to the inclusion in the presence of both EGFP-Rab6A (G) and EGFP-Rab6A(T27N) (H), demonstrating that DsRed-BICD1-CC3(630-975*) localized to the inclusion in a Rab6-independent manner. Asterisks indicate the Golgi apparatus (A and E), and arrows indicate inclusions (C, D, G, and H). Bar, 10 μm.