Isolation and Characterization of Biofilm Formation-Defective Mutants of Staphylococcus aureus

Reagents and bacterial strains.Brain heart infusion (BHI) broth (Difco 256120), tryptic soy broth (TSB) without glucose supplement (Difco 286220), and Mueller-Hinton broth (Difco 212322) were used according to the manufacturer's recommendations. Recombinant lysostaphin was obtained from AMBI Products, LLC (Lawrence, New York). All chemical reagents used were analytical grade or better. S. aureus strain S30 is a pediatric isolate from a catheter-related bacteremia from the University of Geneva Hospital collection. It shows a typical methicillin-susceptible S. aureus antibiotic profile with resistance only to penicillin. S30 is classed by multilocus typing as 3-3-1-1-4-4-3 type ST8. S30 is fully pigmented, is hemolytic on blood agar, and shows a stable and strong biofilm-forming phenotype on a variety of substrates and various culture conditions. S30 has been typed by a subset of phage of the group III international set (3C, 6, 42E, 47, 53, 54, 75, 77, 81, and HK2). S. aureus SA113 (ATCC 15556) and its isogenic derivative SA113Δica::tet have been described previously (9). SA113 ΔtagO does not produce detectable teichoic acid and has been described previously (75). RN4200 is a nonrestricting derivative of NCTC 8325-4, and it was used to shuttle plasmid DNA between Escherichia coli and S. aureus (34).

Plasmids and recombinant DNA methods.Plasmid pWKD56f (W. L. Kelley, unpublished) is based on the E. coli-S. aureus shuttle plasmid pMK4 and contains a gene encoding emission-enhanced green fluorescent protein (GFPuv4). Translational signals were fitted for optimal expression in S. aureus and expressed under the control of the Bacillus megaterium xylose-inducible p_XylR/A′ promoter (31). Plasmid pWKD56f maintenance was selected in E. coli with ampicillin (100 μg/ml) and in S. aureus with chloramphenicol (15 μg/ml). Plasmids used for genetic complementation were constructed as follows. The following primers were designed to incorporate upstream KpnI and downstream PstI restriction sites (underlined) flanking the coding sequence and were used to amplify SA1885 (bfd-7), SA0641 (mgr), and SA1118 (bfd-6) from S30 genomic DNA: SA1885f, 5′-CGGGTACCAAGGAGGAACAATCTTGCAAAATTTTAAAGAACTAG GGTTTC-3′; SA1885r, 5′-AAAACTGCAGTTATTTTTGATGGTCAGCAAATGTG-3′; SA0641f, 5′-CGGGTACCAAGGAGGAACAATCATGTCTGATCAACATAATTTAAAAGAACAGCTATG-3′; SA0641r, 5′-AAAACTGCAGTTATTTTTCCTTTGTTTCATCAAATGCATGAATG-3′; SA1118f, 5′-CGGGTACCAAGGAGGAACAATCTTGAGTTTAATAAAGAAAAAGAATAAAG ATATTC-3′; SA1118r, 5′-AAAACTGCAGTTAAATTTCAGAAATTACTGGAATAATCATAG-3′. Fragments were digested with KpnI and PstI and first subcloned for sequence verification. Confirmed clones were then transferred to pWKD56f by digestion with KpnI and PstI and simple exchange for the GFPuv4 coding sequence. Plasmids were transferred to RN4220 prior to introduction into the appropriate S30 biofilm mutant by electroporation and selection for chloramphenicol resistance. Electroporation was performed as described previously (39) with minor modifications (0.12 μg/ml penicillin G) for enhanced efficiency (52). Complementation assays for biofilm formation were performed with titration of xylose inducer. Negative control experiments were performed using pWKD56f. No effect of the addition of chloramphenicol, or xylose (up to 10% wt/vol), was noted on biofilm formation under conditions of the standard assay.

Mutant generation and screening.The erythromycin resistance-encoding Em-Mu transposon and its chromatographic purification scheme from the carrier plasmid pLEB620 have been described previously (50). The assembly, concentration, and electroporation of Mu transposition complexes have been described previously (36, 50). Chromosomal integrations were selected at 37°C on BHI agar plates containing erythromycin (10 μg/ml). Erythromycin-resistant colonies were picked with sterile toothpicks, and the bacteria were grown overnight in BHI broth supplemented with 15% (vol/vol) glycerol in ordered 96-deep-well plates and then stored at −80°C as master stocks. For rapid primary screening, mutants were inoculated from frozen stocks and grown for 14 h in 96-well polystyrene plates (catalog no. 167008; Nunc) filled with 200 μl of TSB, picked with a plate duplicator, and cultured for a further 6 h in fresh medium in polystyrene plates. The optical density at 600 nm (OD₆₀₀) was then monitored with a Tecan Genios plate reader as an indication for bacterial growth. Supernatants were discarded, and the biofilms were fixed for 20 min at 80°C, followed by staining for 10 min with a solution of 1% (wt/vol) crystal violet solution (CV, Color Gram-2; bioMérieux) freshly diluted twofold in 1% (vol/vol) ethanol-distilled water. After thorough rinsing under running tap water and air drying, residual CV was dissolved for 3.5 h with 300 μl dimethyl sulfoxide on a platform shaker with low-speed orbital agitation at 22°C. Half of the dye was transferred to a fresh plate, and the OD₆₀₀ was measured. Plots of biofilm formation versus OD were generated together with calculation of a mean biofilm formation for the entire population.

Standard CV assay and growth curves.For all biofilm measurements with S30, reference strains, or for stringent screening, overnight cultures (14 h) grown in TSB were harvested by centrifugation, then washed once in phosphate-buffered saline, and passed through 5-μm syringe filters (Sartorius) to reduce aggregation. Optical densities of all samples at 600 nm were equilibrated, and bacterial suspensions were diluted 100-fold into 200 μl fresh medium and placed in polystyrene microtiter plates. Plates were incubated for 6 h at 37°C, then fixed, stained with CV, and measured as described above for primary screening. For the determination of growth curves, the Tecan plate reader was set at 37°C and the plates incubated for 6 h without agitation. Measures at 600 nm were taken every 30 min and plotted.

Genomic DNA extraction.Overnight cultures (5 ml) were harvested by centrifugation for 2 min at 14,000 × g. The pellet was resuspended in 300 μl phosphate-buffered saline supplemented with lysostaphin 300 ng/ml and incubated at 37°C until lysis. Proteinase K was added to a concentration of 200 μg/ml and incubation continued for a further 30 min at 37°C. The solution was extracted three times with 300 μl phenol-chloroform-isoamyl alcohol (25:24:1) and separated with Phase Lock Gel heavy columns (Eppendorf). DNA was ethanol precipitated and resuspended in 100 μl TE (10 mM Tris-HCl, pH 7.5, 1 mM EDTA). RNA was digested with RNase A (500 ng/μl for 30 min at 60°C), and DNA was stored at −20°C.

Inverse PCR and identification of Em-Mu insertion sites.Genomic DNA (5 μl) was digested either with AseI or DraI for 2 h, diluted 40-fold in sterile water, self-ligated with T4 DNA ligase in ligation buffer overnight at 16°C, ethanol precipitated, washed in 70% (vol/vol) ethanol, and then resuspended in a minimal volume (10 μl) of 10 mM Tris-HCl, pH 8.0. Inverse PCRs were then performed on aliquots of the ligation mixtures using primers MuInsert 70-94r, 5′-TTCTCGAGGAATTCTCTAGATGATC-3′, and MuInsert 133-152f, 5′-GCATGCCATGGTACCCTTAG-3′ (see Fig. 2), and Pfu polymerase (Promega). Reactions were 35 cycles using 40°C annealing (1 min) and 72°C (2 min) extension temperatures. The amplicons were gel purified and extracted (QiaQuik; QIAGEN), and the Mu junction flanking sequence was determined by sequencing using an ABI 3100 sequencer (Applied Biosystems) and the primer MuInsert 70-94r. Junction sequences obtained after the Mu repeat were used for BlastN analysis against the S. aureus N315 genome (GenBank accession number NC 002745).

Southern blotting.DNA (30 μl) was digested with AseI and resolved on 1% (wt/vol) agarose gels in TBE (0.5 M Tris-HCl, 0.5 M borate, 5 mM EDTA) at 1 V/cm. DNA was transferred onto Hybond-N⁺ membranes (Amersham Biosciences) by downward capillary transfer. A 667-bp Em-Mu-specific probe spanning the AseI restriction site in the transposon (see Fig. 2) was amplified and [α-³²P]dCTP radiolabeled by PCR with primers (P1) MuProbe-f (5′-CGGATCGCGGCCGCTG-3′) and (P2) MuProbe-r (5′-TATCTTGGTGAATTAAAGTGACACGAGTATTCAG-3′). A second 200-bp labeled probe from dnaN was also included to control for loading using primers N315-2206f (5′-CACATTAAAAGCTATTTCACCAAGA-3′) and N315-2406r (5′-ACAAAGAATCGTCCAGGAAGTAC-3′.

Dot blot PIA analysis.Strains were grown overnight in TSB, diluted 1:100 into 2 ml fresh medium, and regrown for 6 h as described for the standard CV assay above. Cultures were harvested by centrifugation, washed once with Tris-buffered saline (20 mM Tris-HCl, pH 7.5, 500 mM NaCl), and then passed through a 5-μm syringe filter unit (Sartorius). Following normalization of optical densities at 600 nm, the samples (50 μl) were applied on a nitrocellulose membrane (Protran; Schleicher & Schuell) with a BioDot microfiltration apparatus (Bio-Rad) according to the manufacturer's specifications. The membrane was fixed for 30 min at 80°C and then stained with Ponceau S to control for loading. Membranes were blocked for 1 h in TTBS (20 mM Tris-HCl pH 7.5, 500 mM NaCl, 0.02% Tween 20) with 3% (wt/vol) skim milk. Rabbit polyclonal anti-PIA antibody (a kind gift of J. Knobloch) was diluted 3,000-fold in TTBS supplemented with 2% (wt/vol) bovine serum albumin (BSA). Membranes were incubated at room temperature for at least 1 h, washed in TTBS (4 times, 10 min each), and then incubated with secondary goat anti-rabbit immunoglobulin G horseradish peroxidase-conjugated antibody (Amersham Biosciences). Membranes were washed in TTBS (4 times, 10 min each) and then developed with SuperSignal West Pico chemiluminescent substrate (Pierce) according to the manufacturer's recommendations. Control experiments with every strain revealed undetectable secondary antibody binding to S. aureus protein A under the conditions of the assay.

Wall teichoic acid extraction and gel analysis.Overnight cultures in TSB were harvested by low-speed centrifugation, disrupted with glass beads, and ultracentrifuged to obtain crude membrane extracts essentially as described previously (18). Extracts were sodium dodecyl sulfate purified, and the wall teichoic acids (WTA) were isolated with extraction in 5% (wt/vol) trichloroacetic acid as described previously (54). WTA were resolved on a 15% (wt/vol) polyacrylamide TBE gels and then revealed by a modified Alcian blue silver staining as described previously (76).

Immunofluorescence microscopy.Strains harboring GFPuv4-expressing plasmids were grown overnight in the presence of 2% (wt/vol) xylose. Cultures were washed and diluted 1:100 into fresh medium with xylose and incubated at 37°C in polystyrene six-well plates. Growth medium was removed by gentle pipette aspiration, and biofilms were washed with fresh medium. Images of live biofilms were captured directly using a Zeiss Axioskop 2 microscope linked to a Zeiss AxioCam charge-coupled device camera. Data were processed with Zeiss Axiovision 3.0 software with identical magnification and exposure conditions.

Statistical analysis.The data for biofilm analysis were obtained from n = 12 determinations (quadruplicate assay of three independent colonies). Significant differences were concluded when P was <0.01 for pairwise comparisons with Student's one-tailed t test. Biofilm formation means for the entire mutant population were computed for the Em-Mu set (n = 9,177) using the rapid screen assay and compared with the biofilm formation population mean obtained from 100 independent trials of the S30 wild type. The computed mean biofilm formation value, 2.4, was obtained in each case.

The S. aureus S30 strain produces strong biofilms.Staphylococcus aureus strain S30 is a virulent clinical isolate from the Geneva University Hospital collection. It forms a strong biofilm, which suggested its use as a model for the isolation of new genes involved in biofilm formation.

To establish experimental parameters, S30 was first initially compared in two biofilm assays to a well-known reference biofilm-forming strain, SA113 (ATCC 15556), together with its isogenic derivative SA113 ΔicaADBC::tet, which produces no PIA and displays significantly reduced biofilm formation (9).

Our results showed that S30 produced biofilm more rapidly than the SA113 control strain at the time points measured (Fig. 1). SA113ΔicaADBC::tet did not produce significant biofilm, as expected. None of the strains showed significant differences in growth rate that potentially could account for differences in biofilm accumulation (data not shown). The strong ability of S30 to form biofilms was also confirmed at each time point using a quantitative CV staining assay (Fig. 1).

• Open in new tab
• Download powerpoint

FIG. 1.

Kinetics of biofilm formation by S. aureus strain S30 compared with two standard reference strains. Imaging of live biofilms on polystyrene surfaces by fluorescence microscopy was obtained using strains expressing GFPuv4 under the control of the pXyl promoter with 2% (wt/vol) xylose. Images were captured using a Zeiss AxioCam charge-coupled device camera and processed with identical magnification and exposure conditions. Quantitation of the three strains was done using a standard CV staining assay (n = 12) and the same time points for the images. Note the approximately twofold increase in biofilm formation for S30 compared to SA113 and the strong quantitative correlation of the CV assay data with the optical imaging (P < 0.01 for all pairwise comparisons with Student's one-tailed t test).

Construction of an insertion mutant library and screening for biofilm mutants.The Em-Mu insertion mutant library was constructed in strain S30 by selection for erythromycin resistance (see Materials and Methods). A total of 9,177 erythromycin-resistant clones were obtained and screened for biofilm formation-deficient mutants following 6 h of growth on polystyrene. This time point was chosen for our screen because wild-type S30 produced a substantial dense biofilm (Fig. 1). Many growth medium formulations were tested at the outset of the study, and the conditions chosen for the genetic screen used tryptic soy broth without glucose supplement. We found that this condition reproducibly showed a significant difference between SA113 and SA113ΔicaADBC::tet over an 8-h interval (Fig. 1 and data not shown) and was therefore a good choice for improving the likelihood of isolating new biofilm-defective mutants in S30.

Candidate biofilm-forming mutants, which were identified in the primary screen (150), were reinoculated from master stocks and retested. The biofilm formation mean (CV assay) of the entire mutant population was experimentally indistinguishable from the biofilm formation mean obtained from 100 independent experimental trials of wild-type S30 using similar growth and assay conditions (data not shown). Forty-one mutants were retained which fell below two standard deviations of the biofilm formation mean of the entire mutant library and exhibited growth rates in liquid medium similar to those of the S30 wild-type control.

Number of transposon copies and physical mapping of insertion sites.To analyze the number of transposon copies present within the genomes of mutants, genomic DNA was prepared, digested with AseI, and analyzed by Southern blot hybridization using a transposon-specific probe (Fig. 2). We expected to obtain two arbitrary length fragments for each mutant as a unique Em-Mu insertion signature. Three mutants that possessed multiple or ambiguous Em-Mu insertion profiles were rejected by this method (data not shown), leaving 38 mutants for further analysis.

• Open in new tab
• Download powerpoint

FIG. 2.

Diagram of the Em-Mu transposon and the position of probes used for analysis. Em-Mu invert repeat ends are shown as black boxes, and the ermB selectable marker orientation is indicated. Oligonucleotide primers used for inverse PCR (P1, P2) or for Southern blot probing are indicated.

The precise transposon insertion site of each of these 38 mutants was determined by inverse PCR and sequencing. The distribution of inserts on the physical map of the reference S. aureus N315 genome is shown in Fig. 3. Details are given in Table 1.

• Open in new tab
• Download powerpoint

FIG. 3.

Distribution of the Em-Mu insertions on the S. aureus N315 physical map. Multiple inserts were obtained in fmtA and SA1885 as well as the icaADBC operon. Though our screen is not saturating, the incidence of multiple, independent hits for three widely separated chromosomal regions suggests an approach to saturation.

For direct comparison, all 38 mutants obtained were retested in multiple independent trials, normalized to the S30 control (set to 100%), and plotted in decreasing order of their effect on biofilm formation (Fig. 4A).

• Open in new tab
• Download powerpoint

FIG. 4.

(A) Biofilm assay showing the repartition of the 38 Em-Mu single-insertion mutants studied. Wild-type S30 (light gray) was set equal to 100%. Mutants mapping in the icaADBC locus are indicated in dark gray. The data were obtained from n = 12 determinations of a quadruplicate assay of three independent colonies. Raw data points and standard deviation bars are indicated. The inset shows a typical polystyrene microtiter dish assay plate stained with CV. Typical biofilm-positive (+, S30) wells and biofilm-negative (−, SA113Δ ica) wells are boxed and indicated. (B) Restoration of biofilm formation by genetic complementation of the Em-Mu disruption in a quadruplicate microtiter biofilm assay. Mutant strains carrying xylose-inducible complementing plasmids are marked with a “c.” Quantitative measurements are shown graphically. (C) Genetic complementation for disruption of SA1885 in a polystyrene tube assay.

Classifying and complementing mutations.We identified 15 independent insertions in the icaADBC operon that produces PIA. The location of each insertion in each of the four ica biosynthetic genes is depicted schematically in Fig. 3. All ica mutants showed substantially reduced biofilm formation (<70% of S30 wild type) and are highlighted in gray in Fig. 4A. Em-Mu insertion in any of the four genes in the icaADBC operon significantly affected biofilm formation. We conclude from these results that PIA is important for biofilm formation in S30.

Twenty-three Em-Mu insertions did not map within the ica operon. The respective clones showed reduction in biofilm formation comparable to that observed with ica insertions (Fig. 3 and 4A). Ten insertion sites were localized within the coding sequences of known genes (mfd, mgrA, also called norR or rat, fmtA, fmt, codY, glpD, tyrA, srrA, atpF, and gtaB), and one insertion was mapped in the tagGH intergenic region. Nine insertions were mapped in predicted coding sequences that correspond to hypothetical proteins with no previous database annotation and are referred to as bfd for biofilm formation defective (Table 1). In two cases, multiple independent Em-Mu insertions were obtained within the same coding sequence. Three insertions mapped in fmtA, and two insertions mapped in a hypothetical protein coding sequence with ordered locus tag SA1885.

Eleven insertions (Ω8105, 9135, 7586, 5690, 904, 5300, 6900, 1105, 1084, 7546, and 6936) were mapped in hypothetical computer-predicted operons in S. aureus (74). Thus, it is possible that these insertions exert polar effects on downstream gene expression. Interestingly, at least six disrupted genes (mfd, mgrA, codY, srrA, bfd1, and bfd9) are predicted to be involved in signaling pathways or can be confidently classed as transcription factors, suggesting that we have uncovered additional regulators that modulate biofilm development. None of the coding regions in which we obtained insertions has previously been shown to affect biofilm formation in S. aureus.

The Em-Mu insertions that we obtained by our screening procedure suggested, but did not prove, that the disrupted gene affected by each insertion was itself involved in biofilm formation, or alternatively, additional unlinked chromosomal alterations or polar effects were responsible for the phenotype. These issues are usually resolved by backcrossing the mutation with a transducing bacteriophage and/or through genetic complementation with the corresponding wild-type sequence by transformation. Although S30 is susceptible to a few international typing bacteriophage, none of the ones we tried transduced strain S30. Electroporation using high-molecular-weight genomic DNA was also unsuccessful.

We therefore constructed plasmids and attempted genetic complementation of biofilm formation defects in a subset of Em-Mu insertions that did not map in predicted operons. To examine this proof of principle, we first cloned coding sequences for SA0641, SA1885, and SA1118 and placed them under the control of a xylose-inducible promoter in an E. coli-S. aureus shuttle plasmid. As a negative control, we engineered transformants harboring pWKD56f encoding only enhanced green fluorescent protein (GFPuv4). The results of these experiments are shown in Fig. 4B.

We found complete restoration of biofilm formation for two mutants, mgrA and bfd6, and partial restoration for a third, bfd7. Restoration of biofilm formation was comparable for both independent bfd7 mutants. Controls with pWKD56f were all negative (data not shown). The concentration of xylose required for successful complementation for biofilm formation varied in each assay. The reason for the variable dependence on xylose induction is unknown but may reflect characteristics of the expression from this promoter, altered gene dosage, or the influence of partial gene products produced by the Em-Mu disruption.

Effects of Em-Mu insertion on PIA or wall teichoic acid biosynthesis.In light of the importance of PIA in biofilm development, some S30 Em-Mu biofilm formation-defective mutants could act by altering directly, or indirectly, the regulation of PIA biosynthesis or its surface transport. To address this question, we examined PIA production by semiquantitative dot blot analysis of serial dilutions of fixed whole cells. For PIA reactivity, we assigned the mutants categories designated as PIA positive (+, >80% level compared to S30), PIA intermediate (±, >20% and <80% S30), or PIA negative (−, <20% S30 and similar to S30 Em-Mu::icaA) on the basis of digital scans of at least three independent blots and compared to the S30 wild type. The results are listed in Table 1, and representative data for each assigned category are shown in Fig. 5.

• Open in new tab
• Download powerpoint

FIG. 5.

Representative assay for PIA immunoreactivity (icaADBC locus product) or WTA extraction and staining. Six representative S30 mutants corresponding to each category assigned in Table 1 are depicted (WTA/PIA). All immunodot blots show four serial twofold dilutions. Immunoreactivity was scored by digital scans of at least three independent determinations. Wall teichoic acids were extracted, resolved on polyacrylamide gels, and stained with Alcian blue silver. Control experiments for reagent specificity and detection are indicated for SA113 ΔtagO that does not produce teichoic acids (75) and SA113 ΔicaADBC::tet that does not produce PIA (9). ND, not determined. Symbols are as defined for Table 1.

S30 PIA and SA113 PIA immunoreactivity were found to be indistinguishable. In contrast, we observed that the majority of our Em-Mu insertion mutants displayed altered PIA production which may be responsible for some, or even all, observed defective biofilm formation. Specifically, disruption of eight genes (fmtA, fmt, codY, tyrA, bfd4, bfd6, bfd8, and bfd9) resulted in very low PIA reactivity, equivalent to that measured by complete disruption of the icaADBC or Em-Mu insertion in icaA alone (category −). Disruption of nine genes (mfd, mgrA, glpD, atpF, bfd1, bfd2, bfd3, bfd5, and bfd7) resulted in partial reduction of PIA reactivity (category ±). Interestingly, we observed that disruption of gtaB, or the tagGH intergenic insertion, resulted in no measurable alteration in PIA immunoreactivity. In contrast, we observed that disruption of srrA led to consistently enhanced production of PIA antigen (at least four- to eightfold) compared to S30. Thus, we assigned it to a separate category (++) in Table 1 to reflect this observation.

Each S30 Em-Mu insertion mutant was also biochemically fractionated and tested for production of wall teichoic acid, which is implicated in primary attachment to abiotic surfaces (20). As controls, we used SA113 and its isogenic tagO mutant derivative (75), which does not produce detectable teichoic acids and shows reduced biofilm formation (P. Tu Quoc, unpublished). The results are listed in Table 1, and a subset is shown in Fig. 5.

Surprisingly, our results revealed four Em-Mu insertions localized in two genes, fmtA and atpF, which showed no detectable WTA staining. In contrast, all other mutants tested positive for WTA.