Effects of CXCL10 on Dendritic Cell and CD4⁺ T-Cell Functions during Leishmania amazonensis Infection

Mice.IL-10-deficient (IL-10^null) and wild-type (WT) C57BL/6 (B6) mice were purchased from Jackson Laboratory (Bar Harbor, ME). Mice were maintained under specific pathogen-free conditions and used at 6 to 10 weeks of age. All protocols were approved by the Animal Care and Use Committee of the University of Texas Medical Branch (Galveston, TX).

Parasites. L. amazonensis (MHOM/BR/77/LTB0016) parasites were used in all of the experiments, and their infectivity was maintained by regular passage through BALB/c mice. Promastigotes were cultured in 20% fetal bovine serum (HyClone, Logan, UT)-supplemented Schneider's Drosophila media (Life Technologies, Rockville, MD) (pH 7) at 23°C.

BM DC culture and parasite infection.BM DCs derived from either WT or IL-10^null mice were cultured in vitro in the presence of 20 ng/ml of murine granulocyte-macrophage colony-stimulating factor (eBioscience, San Diego, CA) according to the methods of our previous report (37). Briefly, at day 8 of culture, DCs were left untreated or were pretreated with recombinant mouse CXCL10 (Leinco Technologies, St. Louis, MO) (200 ng/ml) in the presence of different doses of lipopolysaccharide (LPS) (1, 5, and 20 ng/ml) or 20 ng/ml of LPS of Salmonella enterica serovar Typhimurium (Sigma, St. Louis, MO) plus 20 ng/ml of IFN-γ (Leinco Technologies) for 4 h. In some cases, CD11c⁺ DCs were purified by positive selection using magnetic microbeads (Miltenyi Biotec, Auburn, CA). The purity of CD11c⁺ DCs was >90%. Cells were then infected with promastigotes at an 8:1 parasite-to-cell ratio at 33°C for 12 h and then at 37°C for another 12 h.

Fluorescence-activated cell sorter (FACS) analysis for DC surface markers and intracellular cytokines.The following specific monoclonal Abs (MAbs) were purchased from eBioscience unless stated otherwise: fluorescein isothiocyanate-conjugated anti-CD45RB (C363.16A); phycoerythrin (PE)-conjugated anti-CD83 (Michel-17); anti-IL-12 p40 (C17.8); and PE-Cy5-conjugated anti-CD11c (N418) as well as isotype control Abs, including fluorescein isothiocyanate-conjugated rat immunoglobulin G2a (IgG2a), PE-conjugated rat IgG2a, and IgG2b and PE-Cy5-conjugated hamster IgG. All staining steps were performed on ice. For intracellular staining of IL-12 p40, DCs were infected with parasites for 24 h, and 1 μl GolgiStop (BD Biosciences, San Jose, CA) was added 6 h before harvest. Cells were washed and blocked for nonspecific Ab binding and Fc receptors for 30 min by use of purified anti-mouse CD16/32, hamster IgG (Pierce, Rockford, IL), and 2% rat serum (Sigma). Cells were stained for CD11c and CD45RB as well as CD83 (not shown), and the latter was used as an additional marker to ensure proper DC activation among the different experiments. After surface staining, cells were fixed and permeabilized with a Cytofix/Cytoperm kit (BD Biosciences) and then stained for IL-12 p40. Appropriate isotype controls were included for both surface and intracellular staining. Cells were analyzed on a FACScan system (BD Biosciences) using FlowJo software (TreeStar, Ashland, OR). The mean fluorescence intensities (MFI) were calculated by subtracting the MFI of a given cell from the value obtained for its analogous conjugate isotype control MAb.

Isolation and stimulation of CD4⁺ T cells.CD4⁺ T cells were purified from the spleens of naïve B6 mice or from the draining lymph nodes (DLN) of B6 mice infected with 2 × 10⁶L. amazonensis cells for 8 to 10 weeks via negative selection using magnetic beads (Miltenyi Biotec). FACS analysis indicated ∼95% CD4⁺ purity. Isolated CD4⁺ T cells were plated in 12-well plates at a concentration of 1 × 10⁷ cells/well. Cells were left untreated or treated with CXCL10 (200 ng/ml) or with concanavalin A (Sigma) (2 ng/ml) for 24 h. Total RNA was then extracted via the use of Tri reagent (Sigma).

RT-PCR analysis for cytokine expression.Total RNAs (200 ng) were subjected to reverse transcription-PCR (RT-PCR) analysis, and annealing temperatures were at 58°C for β-actin and at 59°C for IL-12Rβ₂ and IFN-γ. Primer sequences (listed as 5′ to 3′) were as follows: IL-12Rβ₂ F, GGGGCTGCATCCTCCATTAC; IL-12Rβ₂ R, AAGTGCTGTTTGCTGGATCTG; IFN-γ F, CATTGAAAGCCTAGAAAGTCTG; IFN-γ R, CTCATGGAATGCATCCTTTTTCG; β-actin F, CCAGCCTTCCTTCCTGGGTA; β-actin R, CTAGAGCATTTGCGGTGCA. The expected PCR products are 405 nucleotides (nt) for IL-12Rβ₂, 267 nt for IFN-γ, and 350 nt for β-actin.

DC-T-cell co-culture and T-cell proliferation assay.Purified CD4⁺ T cells (2 × 10⁵) were co-cultured with parasite-infected, mitomycin C-pretreated (30 min) DCs (2 × 10⁴) in round-bottomed, 96-well plates for 4 days in a total volume of 200 μl. Culture supernatants were harvested for cytokine detection. To determine CD4⁺ T-cell proliferation data, 1 μCi of [³H]thymidine was added 18 h before harvest. Incorporated radioactivity was determined (in counts per second) on a microplate scintillation and luminescence counter (Packard Instrument Company, Downers Grove, IL).

Cytokine ELISA.Cytokine levels in the supernatants of infected DCs and T cells as well as in DC-T-cell co-cultures were measured by enzyme-linked immunosorbent assays (ELISA) specific for IL-12 p40, IL-10, and IFN-γ (BD Biosciences). Detection limits were 16 pg/ml for IFN-γ, 4 pg/ml for IL-10, and 10 pg/ml for IL-12 p40.

Data analysis.To evaluate the statistical significance of data among different groups, a one-way analysis of variance with a Tukey's multiple comparison posttest was performed utilizing GraphPad Prism version 4.00 for Windows (GraphPad Software, San Diego, CA). A difference in mean values was deemed significant at P <0.05 or very significant at P <0.01. To determine the statistical difference in calculated MFIs, a Student's two-way t test was also performed.

Modulation of IL-12 and IL-10 production by CXCL10-treated DCs.We have shown that CXCL10 can stimulate murine MΦs to produce several proinflammatory cytokines and chemokines, and intradermal injection of CXCL10 reduced lesion development in susceptible C57BL/6 mice (46). Given the known expression of CXCR3 on DCs (24) and the critical roles of DCs in innate and acquired immunity to Leishmania parasites (13, 37), we investigated here the stimulatory effects of CXCL10 on BM DCs. We first focused our study on CD45RB^lowCD11c⁺ DCs, since this subset is activated (expressing high levels of CD40 and CD83) and is the major producer of IL-12 p40 in response to infection with Leishmania promastigotes (50). We also determined that 200 ng/ml of CXCL10 was the optimal dose for treatment, since higher concentrations did not significantly change the percentage of IL-12 p40-producing cells observed (data not shown). As shown in Fig. 1A, following treatment with 200 ng/ml of CXCL10 for 24 h, ∼9.5% of uninfected CD45^lowCD11c⁺ DCs were positive for intracellular IL-12 p40, which represented a 3.5-fold increase in comparison to findings obtained with untreated cells (2.6%). As expected, DCs treated with LPS/IFN-γ displayed an eightfold increase in IL-12 p40-producing DC levels compared to results obtained with untreated cells. In addition, the MFIs of CXCL10-treated DCs (86.1 ± 19.7; P < 0.05) were also significantly elevated, and in the case of LPS/IFN-γ (303.8 ± 57.2) highly elevated, in comparison to findings obtained with untreated controls (32.7 ± 9.7; P < 0.001). No IL-10-producing cells were detected in any group by intracellular staining (data not shown). Using ELISA, we found a significant elevation of IL-12 p40 production (Fig. 1B; P < 0.05). In the presence of different doses of LPS (1 to 20 ng/ml), we found that CXCL10 could enhance the production of IL-12p70 and IL-10 from LPS-stimulated bulk or purified DCs (Fig. 1C and 1D). These observations suggest that CXCL10 treatment can enhance DC function, which is critically important for the control of Leishmania infection (46).

• Open in new tab
• Download powerpoint

FIG. 1.

Modulation of IL-12 and IL-10 production by CXCL10-treated DCs. BM DCs of C57BL/6 mice were seeded in 12-well plates (3 × 10⁶ cells/well) and were subsequently treated with 200 ng/ml of CXCL10 with or without 20 ng/ml of LPS and IFN-γ (A and B) or in the presence of different doses (1, 5, and 20 ng/ml) of LPS (C and D) for 24 h. Purified CD11c⁺ DCs were used to produce the data presented in panel D. (A) DCs were collected and stained for surface expression of CD11c and CD45RB molecules plus intracellular IL-12 p40. Percentages of positively stained cells gated on CD11c⁺ cells are shown. The MFI of intracellular IL-12 p40 production was corrected by subtracting the MFI of isotype controls. Data represent five independent experiments with similar results. The levels of IL-12 p40 (B) and IL-12p70 and IL-10 (C and D) in the supernatants were assayed by ELISA. Results represent means ± standard deviations of the results of four independent experiments performed in duplicate. * (P < 0.05) and ** (P < 0.01) indicate statistically significant differences between the treated groups and medium controls.

Exogenous CXCL10 does not reverse the immunomodulatory effect of L. amazonensis on IL-10.Since Leishmania parasites can modulate DC activation and function (9, 28, 37), we next examined the effect of CXCL10 on DC maturation and activation during L. amazonensis infection. DCs infected with promastigotes (8:1 parasite-to-DC ratio) for 4 h prior to treatment with CXCL10 showed enhanced DC activation, as judged by high frequencies of both CD83⁺CD45RB^low DCs (data not shown) and IL-12-producing cells (Fig. 2A). The presence of exogenous CXCL10 increases (from 1.02% to 10.54%) IL-12 p40 levels in uninfected cells (MFI, 28.68 ± 8.3 to 102.12 ± 8.6; P < 0.05), as well as IL-12 p40 levels in L. amazonensis-infected cells, but not to the degree observed in naïve DCs (from 5.96% to 7.32%) (MFI, 50.38 ± 10.0 to 70.72 ± 8.9). IL-12 p40 ELISA results further confirmed the observations from FACS staining (Fig. 2B). Although CXCL10 treatment could reduce IL-10 production from uninfected DCs, it did enhance IL-10 production from L. amazonensis-infected DCs with or without the stimulation of 20 ng/ml LPS (Fig. 2B and 2C). Also, the suppressed IL-12p70 production following L. amazonensis infection in the presence of LPS was partially reversed by CXCL10 treatment (Fig. 2C). Similar results were observed using purified CD11c⁺ DCs (data not shown). These observations imply that although CXCL10 treatment consistently enhanced IL-12 production from DCs, CXCL10 appeared to suppress IL-10 production in the absence of parasite infection but appeared to promote IL-10 production from L. amazonensis-infected DCs.

• Open in new tab
• Download powerpoint

FIG. 2.

Exogenous CXCL10 does not reverse the immunomodulatory effect of L. amazonensis on IL-10. BM DCs of B6 mice were seeded in 12-well plates (3 × 10⁶ cells/well) and infected with 2.4 × 10⁷L. amazonensis (La) promastigotes. At 4 h postinfection, cells were treated with 200 ng/ml CXCL10 alone (B) or in the presence of 20 ng/ml of LPS (C) for 24 h. (A) DCs were collected and stained for surface expression of CD11c and CD45RB molecules plus intracellular IL-12. Percentages of positively stained cells gated on CD11c⁺ cells are shown. Data represent six independent experiments with similar results. The MFI of intracellular IL-12 p40 production was corrected by subtracting the MFI of isotype controls. The amount of IL-12 p40 and IL-10 (B) and of IL-12p70 and IL-10 (C) in the supernatants was assayed by ELISA. Results represent means ± standard deviations of the results from at least three independent experiments performed in duplicate. * (P < 0.05) and ** (P < 0.01) indicate statistically significant differences between the indicated groups.

IL-10^null DCs produce increased IL-12 levels following CXCL10 treatment.IL-10 is a well-known, immunosuppressive cytokine that is essential in down-modulating immune responses to numerous pathogens and preventing immune pathology (28). Indeed, DCs that matured in the presence of IL-10 gave rise to regulatory DCs, which promoted T-cell anergy and tolerance (49). L. amazonensis parasites have been shown to down-regulate IL-12 production in DCs and to limit DC antigen-presenting functions via multiple mechanisms that include, but are not limited to, IL-10 release (22, 37). To assess the involvement of IL-10 in CXCL10-mediated DC activation, we utilized BM DCs from IL-10^null mice. Compared to WT DCs, IL-10^null DCs exhibited elevated baseline production of IL-12 p40 as well as stimulation- or infection-induced IL-12 secretion (Fig. 3). Consistently, we observed that, in comparison to the results seen with their WT counterparts, deletion of IL-10 resulted in approximately 3% and 7% increases in the frequencies of IL-12 p40-producing DCs following treatment with CXCL10 and infection with parasites, respectively (Fig. 3A). Most strikingly, there was a nearly 11% increase in frequencies, as well as a very significant rise of MFIs, of IL-12 p40-producing cells in L. amazonensis-infected, CXCL10-treated IL-10^null DCs in comparison to the results seen with their WT counterparts (P < 0.01). Consistent with these FACS data, ELISA analysis (Fig. 3B) also showed a significant increase in IL-12 p40 production in all IL-10^null groups versus their WT DC counterparts (P < 0.05) as well as among IL-10^null DCs following treatment with CXCL10 and parasite infection (P < 0.05). Collectively, these data indicate that abrogation of endogenous IL-10 can markedly enhance CXCL10-mediated and Leishmania infection-mediated DC activation via promoting IL-12 production.

• Open in new tab
• Download powerpoint

FIG. 3.

IL-10^null DCs produce increased IL-12 following CXCL10 treatment. BM DCs of WT and IL-10^null B6 mice were seeded in 12-well plates (3 × 10⁶ cells/well) and were infected with 2.4 × 10⁷L. amazonensis (La) promastigotes. At 4 h postinfection, cells were treated with 200 ng/ml CXCL10 for 24 h. (A) WT and IL-10^null DCs were collected and stained for surface expression of CD11c⁺ and CD45RB molecules plus intracellular IL-12. Percentages of positively stained cells gated on CD11c⁺ cells are shown. The MFI of intracellular IL-12 p40 production was corrected by subtracting the MFI of isotype control. Representative data from one of three independent experiments with similar results are shown. (B) The amounts of IL-12 p40 in the supernatants were assayed by ELISA. Results represent means ± standard deviations of the results from three independent experiments performed in duplicate. * (P < 0.05) represents statistically significant differences between the indicated groups. “n.s.” indicates groups whose results were not statistically significant (P > 0.05).

Differential effects of CXCL10 on WT and IL-10^null CD4⁺ T-cell activation.To further determine the interplay of CXCL10 and IL-10 in DC antigen-presenting cell (APC) function during L. amazonensis infection, we used an in vitro T-cell priming assay. CD4⁺ T cells were purified from the spleens of naïve WT and IL-10^null B6 mice and coincubated with mitomycin C-treated WT and IL-10^null DCs that were previously infected with L. amazonensis and then treated with CXCL10 for 24 h. The proliferation of CD4⁺ responder T cells was measured after 4 days of co-culture. While CXCL10 treatment of DCs alone had no, or a marginal, effect on CD4⁺ T-cell proliferation, there was a significant increase in the proliferation of IL-10^null CD4⁺ T cells co-cultured with CXCL10-treated IL-10^null DCs versus WT CD4⁺ T cells incubated with CXCL10-treated WT DCs (Fig. 4A; P < 0.01). Of note, proliferation of IL-10^null CD4⁺ T cells was substantially increased following incubation with L. amazonensis-infected, CXCL10-treated IL-10^null DCs compared to the results obtained with their WT analogues (P < 0.01) as well as with IL-10^null CD4⁺ T cells co-cultured with L. amazonensis-infected IL-10^null DCs (Fig. 4A; P < 0.01). These observations suggest that in the absence of IL-10, CXCL10 can promote the priming and expansion of L. amazonensis-specific CD4⁺ T cells.

• Open in new tab
• Download powerpoint

FIG. 4.

Differential effects of CXCL10 on WT and IL-10^null T-cell activation. BM DCs of WT and IL-10^null mice were infected with L. amazonensis (La) promastigotes for 24 h in the absence or presence of CXCL10 (200 ng/ml), treated with mitomycin C (50 mg/ml), and then co-cultured with spleen-derived, naïve CD4⁺ T cells (2 × 10⁶/ml) at a 1:10 ratio of DCs to T cells. (A) After 96 h of co-culture, CD4⁺ T-cell proliferation was measured by a ³H-uptake assay. (B and C) Culture supernatants were collected at 4 days of stimulation for measurement of the levels of IL-10 (B) and IFN-γ (C) by ELISA. (D) Proliferation of co-cultured WT and IL-10^null DCs and CD4⁺ T cells was also measured at the indicated settings. (E) Culture supernatants were harvested at 4 days of stimulation and measured for IFN-γ levels by ELISA. Representative data from one of three independent experiments with similar results are shown. * (P < 0.05), ** (P < 0.01), and *** (P < 0.001) indicate statistically significant differences between the indicated groups.

Since activation of CD4⁺ T cells is responsible for both protective immunity and disease pathogenesis, depending on the magnitude of Th1-type responses (19, 20, 23, 42), we used DC-T-cell co-culture assays to determine whether CXCL10 treatment of DCs could increase the production of Th1-biased cytokines. As expected, we found that IL-10 secretion was significantly decreased among all IL-10^null groups in comparison to results seen with their WT counterparts (Fig. 4B; P < 0.05). WT CD4⁺ T cells co-cultured with CXCL10-treated WT DCs showed a highly significant decrease in IL-10 production compared to the untreated control results (P < 0.05), suggesting that CXCL10 treatment can also suppress IL-10 release in CD4⁺ T cells as well as in DCs (Fig. 2B). IFN-γ secretion increased when IL-10^null CD4⁺ T cells were co-cultured with CXCL10-treated IL-10^null DCs, although not significantly. We did observe a statistical increase in IFN-γ levels in groups exposed to L. amazonensis alone or to L. amazonensis plus CXCL10 (Fig. 4C; P < 0.05). Together, these results suggest that in the absence of IL-10 from both DCs and T cells, CXCL10 treatment can markedly promote priming of CD4⁺ T cells to become antigen-specific Th1 cells.

To further examine the source of IL-10, we utilized a cross-co-culture system in which IL-10 was eliminated from either CD4⁺ T cells or DCs. As shown in Fig. 4D, there was a significant increase in the proliferation of WT CD4⁺ T cells when IL-10 was eliminated from L. amazonensis-infected, CXCL10-treated DCs in comparison to the findings obtained with IL-10^null CD4⁺ T cells incubated with L. amazonensis-infected, CXCL10-treated WT DCs (P < 0.05) and L. amazonensis-infected, IL-10^null DCs (P < 0.05), suggesting that IL-10 inhibited DCs to properly signal CD4⁺ T cells to expand. In addition, we consistently observed that eliminating IL-10 from CD4⁺ T cells significantly impacted increased T-cell IFN-γ production (Fig. 4E; P < 0.05 and P < 0.01). Collectively, these data illustrate the important role of IL-10 in modulation of both DC and T-cell functions.

CXCL10 directly stimulates CD4⁺ T cells to express the IL-12Rβ₂ chain and produce IFN-γ.Given that L. amazonensis-infected mice are deficient in Th1 cell activation (20, 22) due to an IL-4-independent down-regulation of the IL-12Rβ₂ chain on CD4⁺ T cells (22, 23), we therefore examined whether CXCL10 treatment could overcome these deficiencies on CD4⁺ T cells. CD4⁺ T cells were isolated from the spleens of naïve mice, treated with 200 ng/ml of CXCL10 for 24 h, and subjected to RT-PCR analysis. While IL-12Rβ₂ mRNA was undetectable in untreated naïve CD4⁺ T cells (Fig. 5A, lane 1), CXCL10 treatment resulted in a 2.5-fold increase in the expression of the IL-12Rβ₂ chain (Fig. 5A, lane 3, and 5B). To determine whether CXCL10 could increase the expression of the IL-12Rβ₂ chain on in vivo-primed CD4⁺ T cells, we isolated CD4⁺ T cells from DLNs of B6 mice that were infected with L. amazonensis for 6 to 8 weeks. These cells were either rested in medium for 24 h or treated with CXCL10 for 24 h in the absence of APCs and antigen prior to RNA isolation. Although primed, rested CD4⁺ T cells expressed low levels of IL-12Rβ₂ but not of IFN-γ (lane 2), CXCL10 treatment led to 3.5- and 2-fold increases in IL-12Rβ₂ and IFN-γ expression (Fig. 5A, lane 4, and Fig. 5B), respectively. These data suggest that CXCL10 can directly stimulate the expression of the IL-12Rβ₂ chain, making CD4⁺ T cells more responsive to IL-12. Although CXCL10 is a downstream molecule induced by IFN-γ, CXCL10 can, in turn, trigger strong IFN-γ gene expression via antigen-dependent and -independent means (27). Consistent with this notion, we found that in vivo-primed, CXCL10-treated CD4⁺ T cells produced significant amounts of IFN-γ (Fig. 5C; P < 0.05). These data suggest that CXCL10 potentially enhances T-cell responsiveness to IL-12 and can stimulate IFN-γ production.

• Open in new tab
• Download powerpoint

FIG. 5.

CXCL10 directly stimulates CD4⁺ T cells to express the IL-12Rβ₂ chain and produce IFN-γ. Naïve CD4⁺ T cells (N) and L. amazonensis (La)-primed CD4⁺ T cells (P) were isolated from the spleens of naïve and DLNs of L. amazonensis-infected B6 mice (8 to 10 weeks old), respectively. CD4⁺ T cells were cultured in the presence or absence of CXCL10 (200 ng/ml) or concanavalin A (Con A) (2 ng/ml) for 24 h. (A) Total RNA (100 ng) was extracted for RT-PCR analyses for determination of IL-12β₂, IFN-γ, and β-actin data. (B) Bands of interest were analyzed via spot densitometry and normalized with their corresponding β-actin controls. Data are presented as severalfold increases in results for CXCL10-treated groups over medium control results; data shown are representative of the results of three independent experiments. (C) The levels of IFN-γ in culture supernatants were assayed by ELISA. Results represent means ± standard deviations of the results from a total of three independent experiments performed in duplicate. * (P < 0.05) represents statistically significant differences between the indicated groups, and n.s. indicates groups with results whose differences were not statistically significant (P > 0.05). KO, knockout.