Article Figures & Data
Figures
- FIG. 1.
NU14 proliferates within PD07i cells. (A) PD07i cells were infected with NU14 for 2 h, and intracellular bacteria were quantified by GPA after 2 h and 24 h of infection. *, P < 0.01 (n = 10). (B) PD07i cells were infected with NU14-GFP for 2 h and incubated with anti-E. coli antibody before fixation to stain extracellular bacteria only. Extracellular bacteria appear red/green (yellow), while intracellular bacteria appear green only. The sample was stained with DAPI to reveal the PD07i cell nucleus (blue). (C) Fluorescence microscopy of PD07i cells infected with NU14-GFP (green) for 24 h and stained with DAPI indicates proliferation of intracellular NU14 in the perinuclear region. (D) PD07i cells infected for 24 h and stained with SYTO 9 dye and DAPI show NU14 spread throughout the cytoplasm. Arrows, extracellular bacteria; arrowhead, PD07i cell nucleolus. Electron microscopy of PD07i cells infected with NU14 for 24 h shows that proliferating NU14 was spread throughout the cytoplasm (E) and in the perinuclear region (F). Arrows indicate nuclear membrane. Scale bars on immunofluorescence images are 5 μm, and scale bars on electron micrographs are 2 μm.
- FIG. 2.
Filipin enhanced intracellular proliferation of UPEC. (A) PD07i cells were infected with NU14 (MOI of 10), and the number of invasive CFU was measured after 2 h (white bars) and 24 h (black bars) by GPA. Intracellular CFU increased after 24 h of infection relative to 2 h of infection of vehicle control-pretreated (MeOH) or filipin-pretreated (1 μg/ml) PD07i cells. *, P < 0.001 (n = 9). (B) Proliferation over 24 h was calculated as change (fold) relative to 2 h (24 h CFU/2 h CFU). Intracellular proliferation significantly increased when PD07i cells were pretreated with filipin. *, P = 0.002 (n = 9). (C) Time course of NU14 intracellular proliferation within vehicle control-pretreated (squares) or filipin-pretreated (triangles) PD07i cells showed that filipin increased intracellular proliferation at 8 h and 24 h (representative experiment, n = 2). (D) PD07i cells were pretreated with different doses of filipin and then infected with NU14 for 2 h. Filipin-induced proliferation was dose dependent (n = 3). (E) Vehicle control-pretreated (white bars) or filipin-pretreated (black bars) PD07i cells were infected with NU14 at different MOIs. Filipin induced intracellular proliferation equally over an MOI range. *, P < 0.001 (n = 3). (F) PD07i cells or NU14 culture was pretreated with vehicle control (−) or filipin (+) prior to infection. Pretreatment of NU14 with filipin did not increase intracellular proliferation. *, P < 0.05 (n = 5). (G) PD07i cells were treated with vehicle control (−) or filipin (+) before (Pre) or after (Post) 2 h of NU14 infection. Filipin-induced proliferation occurred when PD07i cells were filipin treated preinfection but not postinfection. *, P < 0.01 (n = 6). (H) NU14 proliferation within PD07i cells or 5637 cells was similar to that in vehicle control-pretreated cells (white bars). Filipin pretreatment (black bars) induced proliferation in PD07i cells but not in 5637 cells. *, P < 0.001 (n = 3). Values depict the means of independent experiments ± the standard errors of the mean.
- FIG. 3.
Location and morphology of intracellular NU14. (A and B) Fluorescence image of PD07i cells pretreated with filipin and then infected with NU14-GFP (green) for 24 h. Cells were incubated with anti-E. coli antibody to stain extracellular bacteria (red) and with DAPI to indicate the urothelial cell nucleus (blue). Arrows indicate extracellular bacteria. (C) Electron micrograph of PD07i cells pretreated with filipin then infected with NU14 for 24 h suggested proliferating bacteria within a vacuole. An arrow indicates the cell nucleus. (D) PD07i cells pretreated with filipin and infected with NU14 for 24 h were stained with antibodies to Lamp1 (red) and to E. coli (green). The image represents one slice of a Z stack, and the inset represents the entire Z stack. Scale bars on immunofluorescence images are 5 μm, and scale bars on electron micrographs are 2 μm.
- FIG. 4.
Filipin does not affect NU14 invasion of PD07i cells. (A) PD07i cells were pretreated with a vehicle control (MeOH) or filipin (1 μg/ml) and then infected with NU14 (MOI of 10) for 2 h. Invasion was measured by GPA and expressed as a percentage of adherent bacteria. Filipin had no effect on invasion (n = 10), but pretreatment with MβCD (7.5 mg/ml) (B) significantly inhibited NU14 invasion (*, P = 0.007; n = 4). (C) PD07i cells were infected with NU14 as described above after pretreatment with the vehicle control (white bars) or the indicated drug (black bars), and invasion was measured by fluorescence microscopy of samples stained for extracellular and total bacteria as described in Materials and Methods. Invasion was significantly inhibited by MβCD but not filipin. *, P < 0.05 (n = 4). (D) PD07i cells were pretreated and infected as described above and then stained for Lamp1, extracellular bacteria, and total bacteria. Association of intracellular NU14 with Lamp1 was quantified and was unaffected by filipin pretreatment (n = 3). Fluorescence microscopy of PD07i cells infected 1 h with NU14 and stained with DAPI (blue), anti-E. coli antibody (green), and anti-caveolin-1 antibody (red) shows that NU14 localized to caveolin-1 in vehicle control-pretreated (E) and filipin-pretreated (F) PD07i cells. (G) Fluorescence microscopy of PD07i cells infected for 2 h with NU14 and stained with anti-E. coli antibody (green) and Lamp1 antibody (red) shows NU14 within a Lamp1+ compartment. Scale bars are 1 μm. Values depict the means of independent experiments ± standard errors of the mean.
- FIG. 5.
Role of FimH during in vitro IBC formation. (A) PD07i cells were pretreated with vehicle control (white bars) or filipin (black bars) and infected for 2 h with the indicated strain (MOI of 100), and bacterial adherence was measured by colony counts of cell lysates plated on LB agar. *, P < 0.0001. (B) PD07i cells were pretreated with vehicle control or filipin and infected with bacteria for 2 h, and invasive bacteria were quantified by GPA. Filipin significantly increased invasion by NU14-1. *, P < 0.05. (C) PD07i cells were treated with filipin and incubated with bacteria, and after 24 h, intracellular CFU were quantified by GPA. Filipin significantly increased the number of intracellular NU14 and NU14-1 CFU. *, P < 0.05. (D) Immunofluorescence image of a PD07i cell infected with NU14-1 for 24 h and dually stained to differentiate intracellular (green) and extracellular bacteria (red and green; inset image), and counterstained with DAPI (blue; PD07i cell nuclei). (E) Immunofluorescence image of a filipin-treated PD07i cell infected with NU14-1 for 24 h and dually stained to identify intracellular bacteria (SYTO 9 labeled; green) and with DAPI to label the PD07i cell nucleus (blue; arrow). Scale bars are 5 μm. Values depict the means of independent experiments ± standard errors of the means.
- FIG. 6.
In vitro IBCs upregulate expression of putative UPEC virulence factors. PD07i cells were pretreated with the vehicle control (V) or filipin (F) and then infected with NU14 (MOI of 100) for 2 h followed by addition of gentamicin to the culture medium for 22 h. Bacteria were isolated from PD07i cells, and bacterial RNA was harvested as detailed in Materials and Methods. RNA was also prepared from NU14 grown in culture medium (M) under static conditions for 24 h. Each condition was performed in duplicate, and each RNA sample was assayed in duplicate using the 2−ΔΔCT method. Values were normalized to gyrB mRNA levels and are expressed as change (fold) from gene expression in culture medium. Graphs represent the means of three experiments ± standard errors of the mean. *, P < 0.05. (A to G) Genes involved in iron acquisition. (H to N) Putative UPEC virulence factors. See Table 2 for gene details.
Tables
- TABLE 1.
Quantification of intracellular proliferation by UPEC
Parameter % of PD07i cellsa: NU14 NU14-1b Control Filipin Control Filipin No. of bacteria/cell 1-5 78.5 ± 3.2 82.4 ± 0.9 100 ± 0.0 97.3 ± 1.2 6-20 17.9 ± 3.8† 9.7 ± 1.6† 0 ± 0.0 0.7 ± 1.2 >20 3.6 ± 0.9 2.6 ± 0.6 0 ± 0.0 0 ± 0.0 IBCs 0 ± 0.0 5.2 ± 1.2** 0 ± 0.0 2.0 ± 0.02** Total infected cells 19.8 ± 3.5 16.4 ± 1.0 1.2 ± 0.2* 2.1 ± 0.2* ↵a UPEC intracellular proliferation was determined by surveying 50 to 100 PD07i cells containing intracellular bacteria and quantifying the number of cells containing 1 to 5 bacteria, 6 to 20 bacteria, >20 bacteria, or IBCs after vehicle control or filipin pretreatment. *, P < 0.05; **, P < 0.05; †, P < 0.05.
↵b NU14-1 is an isogenic fimH mutant.
- TABLE 2.
Primers for measuring bacterial gene expression
Gene (UTI89 identification no. Putative role in UTIs Protein function Primer Source or reference chuA (C4028) Iron acquisition Heme utilization transport protein Forward, 5′ AAGGCGTTGCCCAATACCAGAGTA 3′ 48, 60 Reverse, 5′ TATTCCGATCGCTCACAGTGGCTT 3′ fepA (C0584) Iron acquisition Ferric enterobactin receptor Forward, 5′ ACGTTCAATCATTTCAGGCGGCAC 3′ 6, 48, 60 Reverse, 5′ TCAGCGTGGTAATAACCGCCAGAT 3′ iroN (C1118) Iron acquisition Salmochelin siderophore receptor Forward, 5′ ACCGGAACAGGTTGAGCGTATTGA 3′ 48, 60 Reverse, 5′ TGGTGTATAACGACAGCGAACCGT 3′ sitA (C1339) Iron acquisition AB-type ferric iron transport system Forward, 5′ TGGTGACCATCCATCGCTGATTCT 3′ 48, 60 Reverse, 5′ TACGATCCGGCAAATGCACAAACC 3′ entF (C0588) Iron acquisition Enterobactin synthetase F Forward, 5′ TCAGGTGTGCAGCGTACCGATTTA 3′ 6, 48, 60 Reverse, 5′ CCGCAATGTGAATACCCAATGGCA 3′ tonB (C1451) Iron acquisition Energy transduction Forward, 5′ GGTCTGCATTCATGGTGCTGTTGT 3′ 48, 60 Reverse, 5′ CAACCATCGTGACAGAAATCGGCT 3′ ybtS (C2178) Iron acquisition Putative salicylate synthetase Forward, 5′ GCAAACAGCCTCCAGTTCAGCAAT 3′ 48 Reverse, 5′ TGGTGATGTCAGTGACGGGCAATA 3′ fliC (C2124) Motility Flagellar filament protein Forward, 5′ GCGCTTTCGACATGTTGGACACTT 3′ 60 Reverse, 5′ AATTCCGTTCTTCCCTGGGTGCTA 3′ fimA (C5011) Cell adhesion Major type 1 subunit fimbrin Forward, 5′ CTGGCAATTGTTGTTCTGTCGGCT 3′ 1, 60 Reverse, 5′ AACGGTTTGATCAACAGAGCCTGC 3′ flu (C1139) Biofilm formation Antigen 43 Forward, 5′ TAACAGCGTCCGTCTCAGCATTCA 3′ 1,60, 68 Reverse, 5′ AACATCAACGGAAGAATGGCCTGC 3′ yfaL (C2514) Biofilm formation Putative adhesion Forward, 5′ TAATTCGCTGTCGAGCAGTAGCGT 3′ 6 Reverse, 5′ TGACGCTGGCAGGTGAGCTTAATA 3′ kpsD (C3364) K capsule Polysialic acid transport protein Forward, 5′ AGTCAGCTAAATGCCCTGGTCACA 3′ 55, 60 Reverse, 5′ AATCAGACGTCACACCGCCATACA 3′ hlyA (C4926) Pore-forming toxin α-Hemolysin Forward, 5′ TCACGAATTTCCTCACCGGGAGTT 3′ 48, 59, 70 Reverse, 5′ TTATGAAGAGGGAAAGCGGCTGGA 3′ cnf1 (C4921) GTPase deamidase Cytotoxic nectrotizing factor; toxin Forward, 5′ ATGCAGCAAGCAGACGACACTTTC 3′ 7, 47,59 Reverse, 5′ ATATCAGGAGGCGTTGATGGCTCA 3′ gyrB (C4249) NAa Gyrase Forward, 5′ CACTTTCACGGAAACGACCGCAAT 3′ Reverse, 5′ TTACCAACAACATTCCGCAGCGTG 3′ ↵a NA, not applicable.
- TABLE 3.
Comparison of in vivo and in vitro IBCs
IBC characteristic Characteristic present: In vivo In vitro Forms as dense aggregate of coccoid bacteria Yes Yes Is cytosolic Yes No Forms 6-24 h postinfection Yes Yes Secretes polysaccharide Yes NTa Stains for antigen 43 Yes Yes Is deficient as fimH mutant Yes Yesb Requires leuX and surA Yes NT Upregulates iron acquisition systems Yes Yes
