Article Figures & Data
Figures
- FIG. 1.
Verification of S. Typhimurium sensor kinase mutants by Southern blot analysis. Genomic DNA from the indicated strains was digested with HindIII or KpnI and hybridized to sensor kinase gene probes, as follows: a qseC probe amplified using primers QseC-P1 and QseC-P2 (A) or a qseE probe amplified using primers QseE-P1 and QseE-P2 (B) (Table 1).
- FIG. 2.
Effect of 5 mM NE on intestinal secretory and inflammatory responses induced by ST4/74 and mutant strains in bovine ligated ileal loops. The dose per loop was ca. 5 × 109 CFU. (A) Fluid accumulation. The ratio of the volume of fluid accumulated to loop length for each treatment was determined from triplicate loops in each calf. The values shown represent the means and standard errors of the means (SEMs) of the results from six calves for serum-SAPI medium and ST4/74, four calves for ΔqseC and ΔqseE, and two calves for ΔqseCE. (B) Neutrophil influx. Total 111In activity in the contents and mucosa was corrected for loop length and expressed as a ratio of the total activity in loops containing SAPI medium alone. The values shown represent the means and SEMs of the results from four calves for SAPI medium and ST4/74 and two calves for the mutants, with triplicate loops for each treatment in each calf. The results were analyzed using a two-tailed Student t test. Significant differences are indicated: *, P < 0.05; **, P < 0.005.
- FIG. 3.
Effect of NE on expression of T3SS-1, T3SS-2, and motility genes. (A) GFP reporter strains were grown in serum-SAPI medium with or without 5 mM NE for 16 h, and gene expression was measured by GFP fluorescence intensity. The GFP gene fusions were JH3008 carrying a promoterless gfp+ gene, JH3009 harboring ssaG (a T3SS-2 gene fused to gfp+); JH3009 harboring prgH (a T3SS-1 gene fused to gfp+), and JH3016 harboring rpsM (a constitutively expressed gene fused to gfp+). The graph shows the means and SEMs from three separate experiments, with two fluorescence readings for each. (B) Coomassie blue-stained gel of secreted proteins from the ST4/74 wild type and ΔqseC, ΔqseE, and ΔqseCE mutants grown for 4 h at 37°C in the presence (+) or absence (−) of 100 μM NE. The positions of SipA and SipC are indicated and were revealed by peptide sequencing of excised bands (data not shown) and Western blotting with specific antisera for SipA (27) and SipC (34). (C) Motility of ST4/74 and ΔqseC, ΔqseE, and ΔqseCE mutants with no NE (white bars), 5 μM NE (gray bars), and 50 μM NE (black bars). Bars represent means and SEMs (n = 4).
- FIG. 4.
Effect of 5 mM NE on in vivo net replication of S. Typhimurium. Ligated ileal loops were injected with ST4/74, ΔqseC, and ΔqseCE, each containing the pHSG422 plasmid, with or without 5 mM NE. Triplicate loops per calf (two calves) were injected for each treatment. The doses were 3.19 × 109 CFU per loop for ST4/74, 3.2 × 109 CFU for ΔqseC, and 3.16 × 109 CFU for ΔqseCE. The proportions of bacteria containing the plasmid in these three inocula were 0.54, 0.47, and 0.48, respectively. Addition of NE to the inocula did not significantly alter the bacterial numbers or proportions before injection into ileal loops in either experiment. (A) Total bacterial recovery, represented as log10 mean CFU/g of tissue and SEM. (B) Proportion of recovered bacteria containing pHSG422. Bars represent mean proportions and SEMs. The effect of NE was analyzed using a two-tailed Student t test. Significant differences are indicated: *, P < 0.05; **, P < 0.005.
- FIG. 5.
The effect of ferric iron on S. Typhimurium replication and virulence gene expression in serum-SAPI medium. The in vitro net replication of ST4/74 (pHSG422) in serum-SAPI medium for 12 h was determined in cultures with no addition, 5 mM NE, or 25 μM Fe(III) nitrate. (A) Final bacterial numbers. Bars represent means and SEM (n = 11). (B) Proportion of bacteria containing the temperature-sensitive plasmid pHSG422. Bars represent means and SEM (n = 11). (C) The effect of 25 μM Fe(III) nitrate on expression of T3SS-1 and T3SS-2 after growth for 16 h in serum-SAPI medium. The graph shows the means and SEMs from two experiments, with two fluorescence readings for each.
- FIG. 6.
Effect of catecholamines on growth of ST4/74 and ΔqseC, ΔqseE, and ΔqseCE mutants. Overnight cultures of the indicated strains were diluted as shown in the legend into serum-SAPI medium, with or without catecholamines at 100 μM, and grown for 18 h statically at 37°C. Bacteria were enumerated by serial dilutions and plating. None, no addition; Dop, dopamine; Epi, epinephrine. Values represent the means and standard deviations of triplicate platings from duplicate cultures.
- FIG. 7.
The S. Typhimurium qseC and qseE genes are not essential for bovine intestinal colonization. ST4/74 and mutant strains were coinoculated orally into calves. (A) WT versus ΔqseC::Kan mutant (n = 4). (B) WT versus ΔqseC ΔqseE::Kan mutant (n = 3). CIs were determined in samples at 5 days postinfection (except for two calves with the double mutant, which reached their humane endpoints at day 4). The CI was calculated as output ratio (mutant/WT) divided by input ratio (mutant/WT). The mean (horizontal line) and SEM at each site are shown. Output and input ratios were compared using a Mann Whitney test. A P value of <0.05 was taken as significant (indicated by an asterisk).
Tables
- TABLE 1.
Primers used in this study
Primer function and name Sequence (5′-3′) Mutagenesis QseC-For CGCACCGTGCACGGCATCGGCTACACCCTGGGTGACGCATGGTGTAGGCTGGAGCTGCTTC QseC-Rev CGTTTTTGGCAAAAGTCTCTGTTACCAACTTACTACGGCCTCCATATGAATATCCTCCTTA QseE-For GCTTCCCTCGGTTAGCATCTTTTTTATTCTTCTTTTATGTGGTGTAGGCTGGAGCTGCTTC QseE-Rev CGCACCAGGCTTAAATTCATATTAGTGTTTGTCAGATGCAGGCATATGAATATCCTCCTTA Confirmation of mutations by PCR k1 CAGTCATAGCCGAATAGCCT k2 CGGTGCCCTGAATGAACTGC QseC-Up TGCAGTGGAAGTCCATGTTC QseC-Down CCCCGTTGATAATCAGGATG QseE-Up TAGCCCGGCTTTGTTGTATC QseE-Down TGGACGAAAACGTGTGACAT Probe amplification QseC-P1 CAACGTCTCAGCCTGCGC QseC-P2 CTACGGCCTCAAATCCACC QseE-P1 GTGTTTGTCAGATGCAGGC QseE-P2 GTGAGCGACACGTTGAAG
