Interactions of Encephalitozoon cuniculi Polar Tube Proteins

Culture and production of microsporidian spores. Encephalitozoon cuniculi was cultured at 37°C in RK13 cells (rabbit kidney cell line CCL37; American Type Culture Collection, Rockville, MD) as previously described (17). Infected RK13 cells were maintained in continuous culture in minimum essential medium (MEM) supplemented with 7% fetal calf serum and 1% penicillin-streptomycin-amphotericin B (Invitrogen, Carlsbad, CA). Cultures were subpassaged every 3 weeks. Supernatants from infected flasks containing microsporidian spores were collected twice weekly and replaced with fresh medium. Spore concentrations were determined by counting using an improved Neubauer hemocytometer.

Polar tube protein isolation protocol.Polar tube proteins were isolated from other proteins as previously described (14). Spores (3 × 10⁷) in 1% SDS were disrupted with 0.5-μm acid-washed glass beads (Sigma, St. Louis, MO) for 4 min on a Mini-Beadbeater (BioSpec Products, Bartlesville, OK). The disrupted spore suspension was separated from the glass beads and washed five times with 1% SDS, followed by a brief wash with 9 M urea to remove sporoplasm released from broken spores and soluble spore coat proteins. The pellet was then incubated with 0.5 ml of 2% dithiothreitol (DTT) in 1× phosphate-buffered saline (PBS) (pH 7.4), 10 μg/ml of aprotinin and leupeptin (Sigma, St. Louis, MO), and 5 mM EGTA at room temperature for 2 h to solubilize the polar tubes. Protein concentration was determined using the Bio-Rad protein assay (Bio-Rad, Hercules, CA).

Cloning and expression of EcPTP1, -2, and -3.DNA was prepared from E. cuniculi by disrupting spores with 0.5-μm acid-washed glass beads (Sigma, St. Louis, MO) for 2 min on a Mini-Beadbeater (BioSpec Products, Bartlesville, OK), followed by routine phenol chloroform extraction, as previously published (15). EcPTP1, without its signal sequence of 60 bases at the 5′ terminus, was amplified by PCR using the following primers (cloning and/or restriction sites are underlined): EcPTP1-Forward (GACGACGACAAGATGTATTCAGCAACCGCA) and EcPTP1-Reverse (GAGGAGAAGCCCGGTCTAGCAGCATTGG). EcPTP2 and EcPTP3 (truncated) genes were PCR amplified using primer pairs EcPTP2-Forward-EcoRI (GCTGAATTCGTTGTTCCACAGCCCGC), EcPTP2-Reverse-XhoI (CTCGAGTTACTCTAGACCCTCGCCG) and EcPTP3-Forward-EcoRI (GGAATTCAAGCCGCACAACC), EcPTP3-Reverse-NotI (ATTTGCGGCCGCCTATTCCTTCTT), respectively. PCR was performed using PCR SuperMix (Invitrogen, Carlsbad, CA) under the following conditions: 40 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 1.2 min. The amplified EcPTP1 gene was cloned into a pET-41 Ek/LIC vector (Novagen, Gibbstown, NJ) at the ligation-independent cloning site, the EcPTP2 gene was cloned into the EcoRI-XhoI site of pGEX-4T1, and the EcPTP3 gene was cloned into the EcoRI-NotI site of pGEX-4T1. All of the resultant vectors were sequenced to confirm that the correct genes had been cloned and that no mutations had been introduced by the PCR process. These vectors were transfected into BL21(DE3) cells, and the recombinant EcPTP1, EcPTP2, and EcPTP3 proteins were expressed by overnight induction at 37°C using autoinduction medium (Novagen, San Diego, CA) for EcPTP1-pET41 Ek/LIC and 1 M IPTG (isopropyl-β-d-thiogalactopyranoside) for EcPTP2-pGEX-4T1 and EcPTP3-pGEX-4T1.

Expressed recombinant proteins were purified by glutathione S-transferase (GST) affinity chromatography with Sepharose beads using the manufacturer's standard conditions following lysis of bacterial cells by sonication in lysis reagent (50 mM Tris [pH 7.5], 0.1% NP-40, 150 mM NaCl, 0.1 mM DTT, and protease inhibitor cocktail [Pierce Biotechnology, Rockford, IL]). The beads were then incubated with 2× gel sample buffer in boiling water for 5 min and the eluted proteins run on a 10% SDS-PAGE gel. The gels were electrotransferred to an Immobilon-P membrane (Millipore, Bedford, MA) using standard conditions. Immunoblot analysis was carried out using an anti-GST monoclonal antibody (gift of Peter Davis, Albert Einstein College of Medicine) at a 1:1,000 dilution, a peroxidase-conjugated anti-mouse secondary antibody at a 1:5,000 dilution (Pierce Biotechnology, Rockford, IL), and the ECL Western blotting detection reagent (Amersham International, Buckinghamshire, United Kingdom). This confirmed the expression and purification of recombinant proteins of the expected size for recombinant EcPTP1 (rEcPTP1), rEcPTP2, and rEcPTP3.

Polyclonal antibody production.BALB/c mice were used to produce antibodies using rEcPTP1, rEcPTP2, and rEcPTP3. Expressed recombinant proteins were purified by GST affinity chromatography with Sepharose beads as described above. The beads were then incubated for 5 min in boiling water with 2× gel sample buffer and the eluted proteins run on a 10% SDS-PAGE gel which was stained with Coomassie blue. The band containing the expressed protein was cut out of the SDS-PAGE gel and homogenized in PBS, and the polymerized acrylamide was removed by passage of the homogenate through a 0.2-μm Nalgene filter. The average concentration of protein obtained was 1 mg per ml with a yield of about 300 μl. Purified protein was emulsified with Hunter's TiterMax adjuvant (CytRx, Norcross, GA) and injected into groups of 3 mice for each protein. Each mouse received about 100 μg of recombinant protein. Four weeks later, the animals received a second injection of purified protein. Sera from injected mice were collected a week after the last injection, aliquoted into 25-μl samples, and stored at −20°C.

Immunoblot analysis.Lysates of E. cuniculi spores were placed in 2× gel sample buffer (100 mM Tris [pH 6.8], 2% SDS, 5% 2-mercaptoethanol, 15% glycerol, 0.01% bromophenol blue) and then separated using 10% SDS-PAGE. Gels were electrotransferred to Immobilon-P membranes (Millipore, Bedford, MA) using 25 mM Tris, 480 mM glycine, and 20% (vol/vol) methanol buffer and then blocked with 5% nonfat dry milk in PBS. Blots were incubated for 1 h with antibody to rEcPTP1, rEcPTP2, or rEcPTP3 at a 1:1,000 dilution, washed in PBS, incubated for 1 h with alkaline phosphatase-conjugated anti-mouse antibody (Pierce Biotechnology, Rockford, IL) at a 1:5,000 dilution, and then washed in PBS. The reaction was detected with BCIP (bromochloroindolyl phosphate)-nitroblue tetrazolium (NBT) using standard protocols.

Electron microscopy. E. cuniculi-infected host cells were fixed for 20 min at room temperature in 2% paraformaldehyde and 1% glutaraldehyde in PBS and rinsed four times in PBS. The samples were dehydrated in 50, 70, and 85% ethanol, infiltrated with complete LR White resin, placed into gelatin capsules with fresh LR White resin, and polymerized with UV light at room temperature for 24 h. The sections were collected onto Formvar-coated Ni grids.

For immunoelectron microscopy, the sections were blocked at 4°C overnight in PBS containing 5% bovine serum albumin (BSA), 5% normal goat serum, and 0.001% Tween 20. The sections were incubated at 37°C for 1 h in primary antibody (anti-rEcPTP1, anti-rEcPTP2, or anti-rEcPTP3) at a 1:100 dilution in PBS containing 5% BSA and 0.001% Tween 20. The sections were then rinsed three times in PBS, blot dried between rinses, and incubated at 37°C for 1 h with anti-mouse 6-nm gold bead antibody (Jackson ImmunoResearch, West Grove, PA) in PBS containing 5% BSA and 0.001% Tween 20. The sections were then rinsed three times in PBS and three times in water and air dried overnight. All sections were then stained with 1% uranyl acetate for 30 min, rinsed three times in water, air dried, and examined using a Techni-12 electron microscope at 80 to 100 kV. Images were recorded on Kodak 4489 film and then scanned into Adobe Photoshop.

Immunofluorescent staining.A T25 flask of RK13 cells infected with E. cuniculi was harvested with trypsin-EDTA, and the cell suspension was added to three Nunc two-chamber slides. The slides were incubated at 37°C for 48 h until the cells were 50% confluent, the culture medium was removed, and the cells were rinsed in PBS, fixed with 4% PBS-buffered formalin for 15 min, and then rinsed in PBS. Following this, the slides were blocked in 10% fetal bovine serum (FBS) in PBS for 1 h at 37°C. The cultures at this point contained spontaneously germinated spores as well as intact extracellular spores, intracellular proliferative life stages, and mature spores. After the cultures were blocked, 100 μl of anti-rEcPTP1 diluted (1:500) in PBS-FBS was added to one chamber of slide 1 and one chamber of slide 2. Anti-rEcPTP2 was added to one chamber of slide 3. The second chamber of slides 1 through 3 were used as controls, so no primary antibody was added to these chambers. Instead, a 1% solution of BSA fraction V in PBS diluted 1:500 in PBS-FBS was substituted for the antibody. All the slides were then incubated for 1 h at 37°C. The chambers were then rinsed three times with PBS and incubated with goat anti-mouse antibody labeled with horseradish peroxidase (HRP)-labeled secondary antibody (Nanoprobes, Inc., Yanpank, NY) for 1 h at 37°C and then rinsed three times with PBS. The slides were then incubated with Tyramide Signal Amplification reagent (Molecular Probes, Eugene, OR) per the manufacturer's instructions. Slides 1 and 2 containing anti-rEcPTP1 and their controls were conjugated with Alexa Fluor 488 (Molecular Probes, Eugene, OR) at a 1:100 dilution for 10 min. Slide 3 containing anti-rEcPTP2 and its control was conjugated with Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100 dilution for 10 min. All the chambers were then rinsed several times with PBS. After this first antibody staining, all the chambers were quenched with 1% hydrogen peroxide in PBS for 5 min, followed by three rinses in PBS, and then they were blocked as previously described. The same procedures, dilutions, and incubations were followed for the second antibody incubation. Both chambers of slide 1 were incubated with anti-rEcPTP2 and conjugated with Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100 dilution for 10 min. Slide 2 was incubated with anti-rEcPTP3 and then conjugated with Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100 dilution for 10 min. Slide 3 was incubated with anti-rEcPTP3 and conjugated with Alexa Fluor 488 (Molecular Probes). All the slides were rinsed several times with PBS and drained, gaskets and chambers were removed, and the slides were mounted in DABCO [1,4-diazabicyclo(2,2,2)octane] (Sigma, St. Louis, MO) and coverslipped. After the various reactions and rinses were completed, the slides were examined on a Zeiss Axiovert 200 using 10×, 20×, and 40× objectives in combination with bright-field, phase, and fluorescence illumination. Areas of interest were then identified on each slide and examined on a Zeiss LSM 510 scanning confocal microscope with a 40× high-resolution objective (Rutgers-Newark Imaging Center). Samples were illuminated with both 488-nm and 565-nm laser lines. Images were collected on a 12-bit photomultiplier tube. Pinhole settings were 1 Airy unit for maximum resolution.

Immunoprecipitation.Protein samples were prepared by glass bead disruption of E. cuniculi spores followed by extraction of polar tube proteins in a 2.5% SDS-100 mM DTT solution containing 10 μg/ml of aprotinin and leupeptin. Protein samples were diluted 50-fold in PBS, and then the diluted protein sample was incubated for 30 min on ice with 4 mM 3,3′-dithiobis(sulfosuccinimidylpropionate) (DTSSP; Pierce), a water-soluble, homobifunctional, thiol-cleavable, and membrane-impermeable cross-linker. The reaction was quenched by the addition of 1 M Tris, pH 7.5, to a final concentration of 50 mM. Samples were centrifuged at 1,000 × g for 30 min and suspended in SDS sample buffer with or without 2-mercaptoethanol (25% vol/vol) for analysis by SDS-PAGE or immunoblotting. As a control, the same reaction was performed without the addition of DTSSP.

Cross-linked polar tube protein extracts prepared from E. cuniculi PTP lysates as described above were immunoprecipitated using anti-EcPTP1 antibody. To create the immunoaffinity reagent, 10 μl of anti-EcPTP1 or anti-mouse IgG was incubated overnight at 4°C with 30 μl of protein A in 500 μl (final volume) of PBS, with agitation. The antibody-protein A affinity reagent was then isolated by centrifugation, washed with PBS, and incubated overnight at 4°C with 100 μg of E. cuniculi cross-linked protein lysate, with agitation. The antigen-antibody-protein A complexes were then centrifuged, washed three times with PBS, added to 2× gel sample buffer in boiling water for 5 min, and used for SDS-PAGE. Immunoblot analysis was then performed using anti-rEcPTP1, anti-rEcPTP2, and anti-rEcPTP3 as described above.

Yeast two-hybrid analysis.Coding regions for full-length (FL) EcPTP1 were amplified from E. cuniculi DNA using the following primers for each construct (cloning and/or restriction sites are underlined): EcPTP1-Full length-Forward-EcoRI (GTCGAATTCTATTCAGCAACCGCACTGTG), EcPTP1-Full length-Reverse-XhoI (CCGCTCGAGCTAGCAGCATTGGACAGC), EcPTP1-N terminus-Forward-EcoRI (CGGAATTCTCAGCAACCGCACTGTGCAG), Reverse-EcPTP1-N terminus-SalI (ACGCGTCGACTCCCTGACACAAAGTGGCT), EcPTP1-C terminus-Forward-EcoRI (CGGAATTCCAGGCCATGCCTAGCACTC), EcPTP1-C terminus-Reverse-SalI (ACGCGTCGACCTAGCAGCATTGGACAGCAGT), EcPTP1-Central-Forward-EcoRI (CCGGAATTCGGAACATCCGGTATTCCTG), and EcPTP1-Central-Reverse-SalI (ACGCGTCGACCTGTCCCTGCTGTCCAG).

Coding regions for EcPTP2 and EcPTP3 were amplified using the following constructs: EcPTP2-Full length-Forward-EcoRI (GTCGAATTCGTTGTTCCACAGCCCGC), EcPTP2-Full length-Reverse-XhoI (CCGCTCGAGTTACTCTAGACCCTCGCGG), EcPTP3-Full length-Forward-EcoRI (GGAATTCTCAAGCTCGCATGCCGTC), and EcPTP2-Full length-Forward-EcoRI-Reverse-SalI (GTCGACCTAACGGGCTACCTTTCC).

Following amplification, each PCR product was then digested with its corresponding enzymes and inserted into the corresponding sites in the yeast two-hybrid vectors pAD and pBD (BD Biosciences Clontech, San Jose, CA). The identity of all clones was confirmed by sequencing the completed constructs.

For interaction studies, competent YRG-2 yeast cells were transformed simultaneously with bait and prey constructs and cultured under a high-stringency screen according to the manufacturer's protocol (Stratagene, La Jolla, CA). Briefly, 100 μl of competent yeast cells, 100 μg of herring sperm DNA, and 10 μg each of pBD construct and pAD construct were added to a microcentrifuge tube and gently mixed. Following this, 600 μl of Tris-EDTA (TE)-Li acetyl-polyethylene glycol (PEG) solution was added, the solution was mixed by vortexing, the tube was incubated at 30°C for 30 min with shaking at 200 rpm, and then 70 μl of dimethyl sulfoxide (DMSO) was added. The samples were then subjected to heat shock at 42°C for 15 min and placed on ice for 10 min. Yeast cells were pelleted by centrifugation at 3,000 rpm for 10 s, resuspended in 0.5 ml TE buffer, and plated onto 150-mm SD-selective plates (250 μl on each plate) that did not contain leucine, tryptophan, or histidine. The plates were incubated at 30°C for 2 to 4 days until colonies appeared. Constructs pADwt and pBDwt were used as the positive control, and pADwt with pLaminC was used as the negative control. Several independent colonies from each interaction screen (i.e., EcPTP1-EcPTP2, EcPTP1-EcPTP3, EcPTP2-EcPTP3, etc.) were chosen and cultured on Leu-, Trp-, His-, and Ade-lacking SD plates at 30°C for 30 h. Those colonies that grew up from Leu-, Trp-, His-, and Ade-lacking SD plates were sequenced to confirm that interacting vectors contained the genes of interest.

Protein expression and polyclonal antibody production.EcPTP1, EcPTP2, and EcPTP3 (truncated) were expressed as fusion proteins as noted in Materials and Methods (data not shown), and polyclonal murine antibodies were prepared using these recombinant proteins. These antisera were able to detect bands corresponding to EcPTP1, EcPTP2, and EcTPTP3 in E. cuniculi lysate (Fig. 1, top). No reactivity was seen in preimmune sera (data not shown). All of these antisera, anti-EcPTP1, anti-EcPTP2, and anti-EcPTP3, reacted with the E. cuniculi polar tube by immunoelectron microscopy (Fig. 1, bottom; polar tubes indicated by arrows). By indirect immunofluorescence assay (IFA), anti-EcPTP1 (Fig. 2A and G), anti-EcPTP2 (Fig. 2D and H), and anti-EcPTP3 (Fig. 2B and E) reacted with spontaneously extruded polar tubes from E. cuniculi. These sera also reacted with polar tubes from E. cuniculi spores germinated by exposure to 1% H₂O₂. The IFA staining seen with anti-rEcPTP1, anti-rEcPTP2, and anti-rEcPTP3 overlapped, suggesting that these proteins were found at similar locations on the polar tubes (Fig. 2C, F, and I). In extruded spores, reactivity of these sera could sometimes be demonstrated to also occur in the residual spores and sporoplasms, which may represent cross-reactive antigens or residual PTPs in these structures. None of the sera had reactivity to the surfaces of intact nongerminated spores (data not shown).

• Open in new tab
• Download powerpoint

FIG. 1.

Analysis of rPTP antisera. Top, immunoblot analysis. Protein lysates were prepared from E. cuniculi run on a 10% SDS-PAGE gel, transferred to nitrocellulose, and examined using anti-rPTP. Anti-rEcPTP1 (1:5,000 dilution), anti-rEcPTP2 (1:5,000 dilution), and anti-rEcPTP3 (1:1,000 dilution) were used. Bands corresponding to EcPTP1, EcPTP2, and EcPTP3 were seen in the corresponding immunoblots. No bands were seen in preimmune sera (data not shown). Bottom, immunoelectron microscopy. E. cuniculi spores (see Materials and Methods for fixation details). (A) Anti-rEcPTP1 (1:100 dilution); (B) anti-rEcPTP2 (1:100 dilution) (insert is an enlarged section of the image); and (C) anti-rECPTP3 (1:100 dilution). All of the antisera react with the polar tube (arrows). Bar length is 600 nm. Gold particles are 6 nm. (D) Representative negative control (preimmune serum at 1:100 dilution). No gold labeling is seen. EN, endospore; Ex, exospore; ANT, anterior portion of the polar filament; R, ribosomes; arrows, polar tubes. Bar length is 500 nm.

• Open in new tab
• Download powerpoint

FIG. 2.

Immunofluorescent analysis of rPTP antibodies. Confocal images of extruded polar tubes of E. cuniculi that were initially incubated with one of the three polar tube antibodies, anti-rEcPTP1, anti-rEcPTP2, or anti-rEcPTP3. After their initial incubation with their respective antibody and tyramide signal-amplified fluorescent label, the polar tubes were dually labeled with a second polar tube antibody and a tyramide fluorescent label (see Materials and Methods). Control preimmune sera did not display any reactivity in this assay. (A, B, C) Images of an E. cuniculi polar tube incubated with anti-rEcPTP1 labeled with Alexa Fluor 488 (green) (A) and anti-rEcPTP3 labeled with Alexa Fluor 594 (red) (B). Panel C is the merged image. Note the presence of both red and green signals along the polar tube and areas of yellow signal where they overlap. Bar length for the group is 5 μm, as shown in panel A. (D, E, F) Images of an E. cuniculi polar tube incubated with anti-rEcPTP2 labeled with Alexa Fluor 488 (green) (D) and anti-rEcPTP3 labeled with Alexa Fluor 594 (red) (E). Panel F is the merged image. Note the presence of both red and green signals along the polar tube and areas of yellow signal where they overlap. Bar length for the group is 5 μm, as shown in panel D. (G, H, I) Images of an E. cuniculi polar tube incubated with anti-rEcPTP1 labeled with Alexa Fluor 488 (green) (G) and anti-rEcPTP2 labeled with Alexa Fluor 594 (red) (H). Panel I is the merged image. Note the presence of both red and green signals along the polar tube and areas of yellow signal where they overlap. Bar length for the group is 5 μm, as shown in panel G.

PTP1, PTP2, and PTP3 interact to form a large protein complex.When polar tube extract was cross-linked using DTSSP, a water-soluble chemical cross-linker, an aggregate was formed at the top of an SDS-PAGE gel which disappeared with 2-mercaptoethanol (25% vol/vol) treatment, which breaks the S—S bond of the cross-linker (Fig. 3A). Immunoblot analysis of cross-linked proteins, immunoprecipitated with anti-rEcPTP1, demonstrates that EcPTP1, EcPTP2, and EcPTP3 are detected (Fig. 3B). These data suggest that anti-EcPTP1 was able to pull down a cross-linked protein complex that included EcPTP1, EcPTP2, and EcPTP3. We therefore sought to investigate which of these proteins could associate with each other.

• Open in new tab
• Download powerpoint

FIG. 3.

EcPTP1, EcPTP2, and EcPTP3 form a protein complex. (A) SDS-PAGE analysis. Coomassie blue-stained gel of protein samples made from E. cuniculi spores, cross-linked with 4 mM DTSSP, without (−) or with (+) treatment with 2-mercaptoethanol (25% vol/vol). Protein markers are in kDa. A large complex (arrow) at the top of the gel disappeared with mercaptoethanol treatment. (B) Immunoprecipitation analysis. Protein samples were extracted from E. cuniculi, cross-linked with DTSSP, and then immunoprecipitated with a control anti-mouse IgG (lane 2) or with anti-rEcPTP1 (lane 3). Lane 1 shows the protein markers (kDa standards). Immunoprecipitates were treated with gel sample buffer (containing reducing agents) and run on 12% SDS-PAGE, transferred to nitrocellulose, and probed with anti-rEcPTP1 (1:2,000), anti-rEcPTP2 (1:2,000), or anti-rEcPTP3 (1:2,000). Reactions were detected with an alkaline phosphatase-conjugated anti-mouse IgG (1:5,000) and detected with BCIP-NBT. Anti-rEcPTP1 was able to precipitate a complex which contained EcPTP1, EcPTP2, and EcPTP3. The control antiserum did not precipitate this complex.

Yeast two-hybrid studies of PTP interactions.The possibility of an interaction among the various PTPs (i.e., EcPTP1, EcPTP2, and EcPTP3) was investigated using yeast two-hybrid analysis. In these experiments, the EcPTPs were analyzed in all possible pair-wise combinations, fused to either the bait vector or prey vector. Full-length EcPTP1 (EcPTP1-FL), EcPTP2-FL, and EcPTP3-FL genes were used as the bait and EcPTP1-FL, EcPTP2-FL, and EcPTP3-FL as the prey to determine if these proteins interacted in vivo using a yeast two-hybrid system. These interactions were repeated by switching the prey and bait vectors. Figure 4 demonstrates that the full-length EcPTP1 protein interacts, in vivo, with full-length EcPTP1, EcPTP2, and EcPTP3 and that full-length EcPTP2 and EcPTP3 also interact with each other in all possible combinations. This is consistent with the hypothesis that EcPTP1 can interact with itself in the formation of the polar tube as well as with other polar tube proteins. It also suggests that PTP2 and PTP3 can also interact with themselves as well as with other PTPs.

• Open in new tab
• Download powerpoint

FIG. 4.

Yeast two-hybrid analysis of PTP interactions. This illustrates the interactions of the pAD and pBD (bait and prey) constructs containing full-length EcPTP1, full-length EcPTP2, and full-length EcPTP3. The negative-control (pBDwt/pADplasminC) and positive-control (pBDwt/pADwt) reactions are provided. This demonstrates that all three EcPTPs can interact with themselves and each other, although the domains responsible for this interaction remain to be determined.

When EcPTP1 is compared to other microsporidian PTP1s, including those of Encephalitozoon hellem and Encephalitozoon intestinalis, the areas of highest similarity are seen in the N-terminal and C-terminal regions (31). These N- and C-terminal regions contain multiple cysteines which are probably involved in the ability of EcPTP1 to form the polar tube, as evidenced by the ability of reducing agents, such as DTT, to solubilize this structure. The central region of the proteins, which has a repetitive motif, is very different among these and the few other microsporidia in which this gene has been cloned. We therefore sought to determine if the observed interactions of EcPTP1 with itself occurs at the N- or C-terminal region of this protein. Figure 5 demonstrates that like the full-length EcPTP1, the truncated N- and C-terminal regions of EcPTP1 were able to interact, in vivo, with each other in all possible combinations.

• Open in new tab
• Download powerpoint

FIG. 5.

Yeast two-hybrid analysis of the interaction of EcPTP1 N-terminal and C-terminal domains. This illustrates the interactions of the pAD and pBD (bait and prey) constructs containing full-length EcPTP1 (EcPTP1-FL), N-terminal Ec-PTP1 (EcPTP1-NT), and C-terminal EcPTP1 (EcPTP1-CT). The negative-control (pBDwt/pADplasminC) and positive-control (pBDwt/pADwt) reactions are provided. This demonstrates that both the N- and C-terminal regions of EcPTP1 can interact with each other and themselves.

The central region of EcPTP1, amino acids 174 to 289, contains a region with a repeated amino acid motif. Although a repetitive motif is present in E. cuniculi, E. intestinalis, and E. hellem, it is different in each of these closely related organisms. We have hypothesized that this region may be involved in antigenic masking of the polar tube and would not be involved in protein-protein interactions in this structure (30, 31). Therefore, a construct expressing the EcPTP1 central gene sequence was produced, and this was studied for its ability to interact with the full-length N-terminal and C-terminal regions of EcPTP1. As demonstrated in Fig. 6, the protein encoded by the EcPTP1 central gene region did not interact with any of the other constructs used in this experiment (i.e., it did not interact with EcPTP1-FL, the N- or C-terminal region of EcPTP1, EcPTP2-FL, or EcPTP3-FL). These interactions were confirmed by switching the prey and bait vectors. In addition, the central region of EcPTP1 did not react with itself (see Fig. S1 in the supplemental material).

• Open in new tab
• Download powerpoint

FIG. 6.

Yeast two-hybrid analysis of the interactions of the EcPTP1 N-terminal, C-terminal, and central-repeat domains of EcPTP2 and EcPTP3. (A) Interactions between EcPTP1-FL as the bait and EcPTP1-FL (1), EcPTP1-NT (2), the central region of EcPTP1 (EcPTP1-Cent) (3), or EcPTP1-CT (4) as the prey. (B) Interactions between EcPTP2-FL as the bait and EcPTP1-FL (1), EcPTP1-NT (2), EcPTP1-Cent (3), or EcPTP1-CT (4) as the prey. (C) Interactions between EcPTP3-FL as the bait and EcPTP1-FL (1), EcPTP1-NT (2), EcPTP1-Cent (3), or EcPTP1-CT (4) as the prey. A positive control (pBDwt/pADwt) (P) and a negative control (pBDwt/pADplasminC) (N) are shown in each group. This demonstrates that the central region of EcPTP1 does not contain any interacting domains. In addition, while EcPTP1-FL can interact with either EcPTP3-FL or EcPTP2-FL, neither the N-terminal nor the C-terminal domains are sufficient for this interaction to occur.

While both N-terminal and C-terminal constructs of EcPTP1 were able to interact with each other and with full-length EcPTP1, we sought to determine if each of these constructs was able to interact with full-length EcPTP2 or EcPTP3 as we had already demonstrated for full-length EcPTP1 (Fig. 4). As shown in Fig. 6, neither the N-terminal nor the C-terminal EcPTP1 construct interacted with EcPTP2 or EcPTP3.