Conidia but Not Yeast Cells of the Fungal Pathogen Histoplasma capsulatum Trigger a Type I Interferon Innate Immune Response in Murine Macrophages

Cell culture and bone marrow-derived macrophage infections.For bone marrow collection, 8-week-old wild-type C57BL/6 mice were obtained from Charles River Laboratories. Macrophages were differentiated from the bone marrow from femurs of 8-week-old mice for 6 days in bone marrow-derived macrophage medium (BMM) containing Dulbecco's modified Eagle's medium (DMEM)-H21, 20% fetal calf serum, 10% colony-stimulating factor (CSF) from 3T3 cells, 2 mM glutamine, 1 mM sodium pyruvate, and penicillin-streptomycin (Pen/Strep) at 37°C in 5% CO₂. Femurs from 8-week-old myd88^−/−trif^−/− double-knockout mice in the C57BL/6 background were obtained from the laboratory of G. Barton, University of California—Berkeley, and differentiated as described above. For all bone marrow-derived macrophage experiments, cells were grown in the same medium. Bone marrow-derived macrophages from mavs knockout (−/−) and mavs heterozygous (+/−) littermate controls were obtained from the laboratory of R. Vance, University of California—Berkeley. Bone marrow-derived macrophages from irf3^−/− mice were obtained from the laboratory of J. Cox, University of California—San Francisco (UCSF).

Bone marrow-derived macrophages were seeded at 7 × 10⁵ cells/well in 6-well dishes or at 2 × 10⁵ cells/well in 24-well dishes in BMM. After 16 to 20 h of growth, macrophages were infected with conidia or yeast cells resuspended in DMEM or phosphate-buffered saline (PBS). Conidia or yeast cells were centrifuged onto macrophages and incubated at 37°C in 5% CO₂ for the times indicated. For quantitative reverse transcription-PCR (qRT-PCR), macrophages were infected at a multiplicity of infection (MOI) of 10 for the times indicated and then were washed twice in prewarmed BMM prior to collection in RNeasy minikit cell lysis reagent (Qiagen). For microarray time course experiments, macrophages were washed 1 h postinfection with prewarmed medium and then collected at the indicated time points in cell lysis reagent.

Mice. ifnar1 ^{− / −} mice that were back-crossed for at least 8 generations to the C57BL/6 background were obtained from the laboratory of J. Cox (74). Age- and sex-matched WT (C57BL/6) mice for infections were purchased from Charles River Laboratories. All mice were handled according to protocols approved by the UCSF Institutional Animal Care and Use Committee.

Histoplasma growth and conidia purification. Histoplasma strains were thawed from frozen stocks as yeast cells onto Histoplasma-macrophage medium (HMM) at 37°C with 5% CO₂ and passaged up to 3 times on plates. For infection of macrophages, yeast cells were grown to early log phase in HMM and washed and resuspended in warm PBS. Clumps of cells were pelleted by centrifugation of 50 ml of culture at 50 g for 5 min in a conical tube. The top 10 ml, which was enriched for single cells, doublets, and triplets, was collected, counted on an improved-Neubauer-phase hemacytometer, and diluted in PBS for infection.

Conidia from the G217B, G184AR, and G184AS strains were obtained by plating approximately 3 × 10⁷ yeast cells on 15-cm petri plates containing synthetic medium 1 (3) or on Bird agar (http://www.fgsc.net/fgn51/fgn51metz.html ) supplemented with cysteine-HCl and penicillin-streptomycin (Pen/Strep) as indicated. The G186AR strain, which grows poorly on synthetic media, was grown on Sabouraud dextrose agar to produce conidia. Plates were sealed in parafilm and cultured at room temperature for 4 to 12 weeks in a biosafety level 3 facility: G184AR and G184AS strains required 10 weeks to produce reasonable numbers of conidia, whereas G217B and G186AR routinely produced adequate yields of conidia within 4 to 5 weeks of incubation. Conidia were harvested by flooding the plates with PBS and dislodging the conidia with a bent glass rod. Mycelial fragments were removed from the conidial suspension by filtration through sterile glass wool. Conidia were pelleted by centrifugation at 2,000 × g, at 4°C for 10 min, washed, resuspended in PBS or PBS with Pen/Strep, and stored at 4°C until use. Conidia were heat killed by incubation in PBS at 95°C for 20 min. Conidial viability was confirmed by plating serial dilutions on brain heart infusion (BHI) agar with 10% sheep blood, 0.05% cysteine-HCl, and 10 μg/ml gentamicin and incubating for at least 10 days at 30°C.

RNA preparation.Macrophage RNA was purified using a RNeasy minikit and Qiashredder columns (Qiagen) according to the manufacturer's instructions with the following modification. Macrophage lysates were centrifuged for 5 min at 14,000 rpm to pellet any yeast cells or conidia prior to loading onto Qiashredder colums. For qRT-PCR analysis, RNA was treated with RQ1 RNase-free DNase I (Promega) for 20 min at room temperature. RQ1 stop solution was added, and reaction mixtures were incubated at 65°C for 15 min to inactivate the DNase I enzyme.

Microarray analysis.Total RNA was amplified to generate anti-sense RNA (aRNA) using the amino allyl MessageAmp II aRNA kit (Ambion). Each sample was labeled with Cy5 and competitively hybridized to a reference sample consisting of a pool of experimental samples labeled with Cy3. The aRNAs were fragmented with RNA fragmentation reagent (Ambion) according to the manufacturer's instructions prior to hybridizing the samples to microarrays. Microarrays were printed at the UCSF Center for Advanced Technology, using the MEEBO (Mouse Exonic Evidence-Based Oligonucleotide) 70-mer oligonucleotide set (Illumina; for more details, see http://alizadehlab.stanford.edu/ ). Microarrays were scanned using Gene Pix Pro 6.0 software on an Axon 4000B scanner (Molecular Devices). Grids were generated for each array with Gene Pix 6.0 (Molecular Devices), and the data were uploaded to the NOMAD database (http://ucsf-nomad.sourceforge.net/ ) for quality control and normalization. Significantly induced genes were determined using the MeV implementation of SAM (Significance Analysis of Microarrays) with a false discovery rate of less than 5%. Information linked to each unique Oligo ID can be accessed at http://meebo.ucsf.edu:8080/meebo/meeboInfo.jsp?oligoid = (insert Oligo ID here). The data were organized for presentation with XCluster (http://genome-www5.stanford.edu/download/ ) and Java Treeview software (22, 70).

qRT-PCR analysis.For qRT-PCR, 1 μg of DNase I-treated total macrophage RNA was reverse transcribed with Affinity Script multitemperature reverse transcriptase (Stratagene) and 500 ng oligo(dT₁₉V) (Integrated DNA Technologies, San Diego, CA) for 2 h. cDNA was diluted 3- to 4-fold with pyrogen-free water. Two microliters of diluted cDNA was used in each 25-μl reaction. Reactions were run on an Mx3000P machine (Stratagene), and MxPro software (Stratagene) was used to determine threshold and threshold cycle (C_T) values. qRT-PCR data were normalized to hypoxanthine phosphoribosyltransferase 1 (HPRT1) expression using the Pfaffl method (63). The IFN-β expression shown is relative to that of the mock-infected control unless otherwise indicated. Data are representative of at least 3 (in many cases 4 or more) independent experiments. Error bars represent the standard error of the mean for replicate qRT-PCRs. The primers used in this study were IFNb-F (CTGGAGCAGCTGAATGGAAAG), IFNb-R (CTTGAAGTCCGCCCTGTAGGT), mHPRT1-F (AGGTTGCAAGCTTGCTGGT), and mHPRT1-R (TGAAGTACTCATTATAGTCAAGGGCA).

Quantitation of phagocytosis and cell staining.For immunostaining, macrophages were seeded in 24-well dishes on 12-mm coverslips and infected as described above. After 2 h, macrophages were washed twice with BMM to remove unbound conidia or yeast cells. Coverslips were fixed in phosphate-buffered saline (PBS) with 3.7% formaldehyde for 5 min and then washed in PBS and stored at 4°C until stained. Extracellular conidia or yeast cells were detected with 1:300 anti-Histoplasma mold or 1:500 anti-Histoplasma yeast cell antibodies (a kind gift of Joseph Wheat, Miravista Labs) in PBS with 1% bovine serum albumin (BSA) for 30 min at room temperature. Goat anti-rabbit Alexa 594 (Molecular Probes) secondary antibody was used at 1:500, concanavalin A-fluorescein isothiocyanate (FITC) (Invitrogen) was used at 1:400 to stain macrophages, and 10 μg/ml calcofluor (fluorescence brightener 28; Sigma-Aldrich) was used to stain all fungal cells (4, 47). Fluorescence images were obtained on a Zeiss Axiovert 200 inverted microscope using Axiovision 4.4 software. Red, green, and blue fluorescent channels were merged with Adobe Photoshop. Cytochalasin D was resuspended in dimethyl sulfoxide (DMSO) and used at a 5 μM final concentration. At least 100 macrophages were evaluated per condition. To visualize germination during macrophage infection, coverslips seeded with conidium-infected macrophages were fixed at 24 h postinfection (hpi) in PBS with 3.7% formaldehyde for 5 min before staining with periodic acid-Schiff (PAS) base (Sigma).

Isolation and infection of AvMs.Bronchoalveolar lavage (BAL) was performed to obtain AvMs from the lungs of 8- to 12-week-old female C57BL/6 mice. Briefly, mice were sacrificed by cervical dislocation and lungs were flushed with a total of 20 ml BAL solution (5 mM EDTA in PBS without Ca²⁺ and Mg²⁺). Cells were pelleted and resuspended in AKT solution (150 mM NH₄Cl, 10 mM KHCO₃, 0.1 mM EDTA in double-distilled water [ddH₂O], pH 7.2 to 7.4) to lyse contaminating red blood cells. The remaining cells were pelleted and resuspended in high-glucose DMEM (UCSF Cell Culture Facility) supplemented with 10% fetal bovine serum (HyClone; Thermo Fisher [www.hyclone.com ]), penicillin, and streptomycin (UCSF Cell Culture Facility). AvMs were seeded at a density of 6.0 × 10⁵ cells/well in 24-well plates and allowed to settle overnight prior to infection with G217B yeast cells or conidia at an MOI of 10. As a positive control for induction of Ifi205, AvMs were treated for 2 h with 100 ng/ml lipopolysaccharide (LPS) (Sigma). Four hours postinfection, AvM total RNA samples were isolated using the RNeasy minikit (Qiagen) and 250 ng total RNA was reverse transcribed using the Affinityscript quantitative PCR (qPCR) cDNA synthesis kit (Agilent). qRT-PCR analysis of Ifi205 expression in AvMs was performed using the same methods as for analysis of IFN-β expression in BMDMs, with the exception that reactions were carried out using SYBR green qPCR master mix (Applied Biosystems). The primer sequences are CATCTTCGGCTTCATCTAAC for Ifi205 fwd and ACATGGAAATACTGGCTCAC for Ifi205 rev.

Mouse infections.Mice were anesthetized with isoflurane and infected intranasally with 2 × 10⁶ conidial CFU (from the G217B strain) or 2 × 10⁴ yeast CFU (from the G217B strain) in a volume of 25 to 40 μl PBS. Since germination of conidia must occur before they give rise to actively dividing yeast cells, and because 100% of the conidia do not germinate, different numbers of infectious particles for conidia and yeast cells were selected to allow a similar progression of fungal burden and disease in both cases. At the indicated time points, mice were euthanized using CO₂ inhalation followed by cervical dislocation. Lungs and spleens were homogenized in Hank's medium supplemented with 10 μg/ml gentamicin with disposable 15-ml conical homogenizers. Dilution series were plated on brain-heart infusion (BHI) agar with 10% sheep blood, 0.05% cysteine, and 10 μg/ml gentamicin at 30°C for 10 to 14 days before enumeration of CFU. P values were calculated using the Mann-Whitney rank sum test.

For histopathological analysis of infected tissues, age- and sex-matched WT and ifnar^−/− mice of the C57BL/6 background were infected intranasally with a suspension of 2 × 10⁶ G217B conidial CFU in sterile PBS. Mice were weighed and monitored for symptoms at regular intervals. At the indicated time points, two mice per strain were euthanized as described above. Postmortem, the trachea was cannulated and the lungs were inflated in situ with 0.7 ml of 10% formalin-PBS. The lungs were removed and fixed in 10% formalin-PBS before serial dehydration and paraffin embedding. Five-micrometer parasagittal sections were taken at 100-μm intervals from the right lungs. At each level, sections were stained for hematoxylin and eosin (H&E) or periodic acid-Schiff (PAS) (Sigma-Aldrich). Sections were analyzed using light microscopy and photographed using a Leica DM1000 with a Leica DFC290 color camera. Images of sections were montaged using Photoshop CS3 (Adobe Systems, Inc.) for additional comparative analysis of inflammatory regions.

Microarray data accession number.The GEO accession number for the microarray data is GSE20022.

Phagocytosis of conidia and infection of murine bone-marrow derived macrophages.Although numerous studies have documented the interaction between macrophages and Histoplasma yeast cells (59, 60), there has been only limited analysis of infection of macrophages with conidia. We generated conidia from the virulent laboratory strain G217B, which has been studied extensively in the yeast form. G217B yeast cells were induced to form filaments and sporulate by incubation on synthetic sporulation medium or on Sabouraud dextrose agar (see Materials and Methods) at room temperature. Under these conditions, near-pure populations of microconidia (>95%) were produced, with the remaining cells in the preparation being macrocondia. To determine whether G217B microconidia (hereafter referred to as conidia) were efficiently ingested by BMDMs, we infected macrophages with conidia or yeast cells (which are known to be efficiently phagocytosed by macrophages) at a multiplicity of infection (MOI) of 3 or 5. After a 2-h incubation period, we used polyclonal antibodies and calcofluor white to detect Histoplasma yeast cells and conidia (see Materials and Methods). Only external Histoplasma cells were accessible to the antibodies, whereas both external and internal fungal cells were accessible to calcofluor white (47), which binds to chitin in the fungal cell wall (Fig. 1A). Quantitation of the staining revealed that conidia and yeast cells were phagocytosed by wild-type macrophages with similar efficiencies (85.8% of yeast cells and 86.4% of conidia associated with macrophages were internalized). Germination of conidia to give rise to yeast cells was observed approximately 16 to 24 h postinfection (hpi) by staining the infected macrophages with periodic acid-Schiff base (PAS) (Fig. 1B). Ultimately, infection of macrophages with conidia resulted in lysis of the macrophage monolayer, as is observed for infection of BMDMs with H. capsulatum yeast cells (data not shown).

• Open in new tab
• Download powerpoint

FIG. 1.

Conidia are internalized by macrophages and germinate intracellularly to give rise to yeast cells. (A) Differential interference contrast (DIC) image (left) and immunofluorescence staining (right) of macrophages infected with conidia of the G217B strain. Both internal and external conidia are stained in blue with calcofluor, whereas only external conidia are stained in red with anti-Histoplasma antibodies. Macrophages are stained green using concanavalin A-FITC. (B) Periodic acid-Schiff (PAS) staining of conidia that have germinated and are producing yeast cells within macrophages 24 hpi. With PAS, conidia typically stain a darker magenta color than yeast cells. Three representative yeast cells are indicated with arrowheads, and two representative conidia are indicated with arrows.

Macrophages infected with conidia express type I interferon response genes.To identify host signaling pathways induced specifically in response to infection by conidia, we used Mouse Exonic Evidence-Based Oligonucleotide (MEEBO) microarrays (Illumina) to determine the transcriptional profile of murine BMDMs infected with G217B conidia or yeast cells. Macrophages were infected at an MOI of 5, and RNA was harvested at 0, 3, 6, and 9 hpi. As expected, we found that infection with both conidia and yeast cells resulted in induction of general inflammatory response genes, including chemokines and cytokines (C. A. Berkes et al., unpublished data). However, a group of 74 genes were significantly induced only in macrophages infected with conidia (Fig. 2; see Table S1 in supplemental material for the gene list). Many of these genes are known to be induced by type I IFNs, suggesting that macrophages were producing type I IFNs specifically in response to infection with H. capsulatum conidia. Induction of type I IFN response genes during infection of macrophages with conidia is interesting because previous reports of type I IFN responses to fungal infection are limited, although signaling through IFNAR1 has been shown to play a critical role in host survival during infection with the fungal pathogen Cryptococcus neoformans (8).

• Open in new tab
• Download powerpoint

FIG. 2.

Heat map of type I IFN response genes induced by macrophages infected with Histoplasma conidia but not yeast. C57BL/6 (WT) macrophages were subjected to either mock infection, infection with H. capsulatum yeast cells, or infection with two independent preparations of H. capsulatum conidia (Con 1 and Con 2). WT and ifnar1^−/− macrophages were mock infected (data not shown) or infected with a third preparation of G217B conidia (Con 3). At 3, 6, and 9 hpi, macrophages were subjected to gene expression profiling. Genes with statistically significant induction in two independent wild-type macrophage infection experiments relative to the mock infection are shown. Yellow indicates gene upregulation, blue indicates downregulation, and black indicates no change. The color bar indicates the log₂ scale.

To test whether the type I IFN signaling pathway is required for the transcriptional response of macrophages to conidia, we infected macrophages deficient in the type I IFN receptor (ifnar1^−/− macrophages) with conidia and examined the resultant transcriptional response. Cells lacking the type I IFN receptor are capable of primary induction of type I IFNs but are deficient in the secondary response that amplifies the primary signal and results in the expression of downstream genes (37, 81). ifnar1^−/− macrophages were unable to mount a wild-type transcriptional response to H. capsulatum conidia (Fig. 2), strongly suggesting that the production of type I IFNs and subsequent signaling through IFNAR are required for the transcriptional response to conidia.

H. capsulatum conidia trigger the induction of IFN-β transcript in macrophages.To confirm our transcriptional profiling data, we used qRT-PCR as a sensitive assay to detect IFN-β expression in infected macrophages. WT macrophages were infected with G217B conidia at an MOI of 10, and RNA was harvested at multiple time points between 1 and 6 hpi. Maximal (12-fold) induction of IFN-β occurred between 3 and 4 hpi and declined by 6 hpi (Fig. 3A). Over the course of multiple experiments, we routinely observed that infection with G217B conidia at an MOI of 10 resulted in a range of IFN-β induction that was largely dependent on the age of the conidia—i.e., conidia purified from plates incubated for a longer period (e.g., 10 weeks) stimulated higher levels of IFN-β message than conidia purified from plates incubated for shorter periods (e.g., 4 weeks). We were not able to detect IFN-β protein production by enzyme-linked immunosorbent assay (ELISA) (data not shown), although the dependence of the host transcriptional signature on IFNAR (Fig. 2) strongly suggests that type I IFN proteins are produced and signal through IFNAR during infection of bone-marrow derived macrophages with Histoplasma conidia.

• Open in new tab
• Download powerpoint

FIG. 3.

Expression level of IFN-β in conidium- and yeast-infected macrophages. (A) qRT-PCR analysis to determine fold induction of IFN-β was performed on macrophage samples at various time points after infection with G217B conidia at an MOI of 10. (B) qRT-PCR analysis to determine fold induction of IFN-β at 3 hpi in macrophages infected with live or heat-killed (HK) conidia or with live yeast cells at an MOI of 10. (C and D) Macrophage lysates were subjected to qRT-PCR to detect relative induction of IFN-β after mock infection or infection with G217B, G184AR, G184AS, G186AR, or G186AS conidia (C) or yeast cells (D) at an MOI of 10. ND, not determined.

To determine whether induction of IFN-β transcript by Histoplasma is an active process that requires viable spores, we compared the IFN-β responses of WT macrophages infected with live or heat-killed G217B conidia (Fig. 3B). Whereas infection with G217B yeast cells failed to induce IFN-β, infection with heat-killed conidia induced intermediate levels of IFN-β transcript compared to infection with live conidia. Thus, induction of IFN-β does not fully depend on conidial viability and at least partially reflects a heat-resistant property of conidia.

Conidia from evolutionarily diverged Histoplasma strains trigger induction of IFN-β transcript in macrophages.Molecular studies of H. capsulatum biology and pathogenesis have largely taken place in three distinct strains: the North American clinical isolate G217B and the Latin American clinical isolates G186AR and G184AR (“R” indicates that the yeast form of the organism has a rough colony morphology). These strains were originally classified on the basis of the polysaccharide composition of their cell walls (16, 67-69), which is a microbial property that could influence the host immune response. G217B yeast cells lack α-(1,3)-glucan in their cell wall, whereas the cell walls of G186AR and G184AR yeast cells are rich in α-(1,3)-glucan. Variants of G186AR and G184AR that lack α-(1,3)-glucan (the so-called “smooth” G186AS and G184AS strains) are avirulent (44, 45), whereas G217B is virulent despite its lack of α-(1,3)-glucan. Recent molecular phylogeny studies confirmed that G217B is in a phylogenetic clade that is significantly diverged from the G186AR and G184AR lineages (40). To determine whether the IFN-β induction by conidia was a property restricted to the G217B strain or whether spores and yeast cells from other strains could induce IFN-β, we attempted to generate conidia from the G186AR, G186AS, G184AR, and G184AS strains. Like many strains that have undergone extensive laboratory passaging, our stock of the G186AS strain failed to produce conidia (data not shown). However, we were able to produce conidia from G184AR, G184AS, and G186AR yeast cells, as described in Materials and Methods. All of these strains, including G217B, were plated simultaneously and grown for approximately 10 weeks at room temperature. Macrophages were infected with G217B, G184AR, G186AR, or G184AS conidia, and qRT-PCR was used to detect IFN-β induction 4 h after infection (Fig. 3C). Infection with G217B conidia resulted in approximately 25-fold induction of IFN-β, but infection with G186AR conidia failed to induce significant levels of IFN-β. Interestingly, whereas G184AR conidia induced modest levels of IFN-β (7.5-fold), infection with G184AS conidia resulted in a 150-fold induction of IFN-β transcript. These data suggest that the unknown microbial property that triggers production of IFN-β by host cells is enhanced in the smooth G184AS strain and is masked in the rough G184AR and G186AR strains, although the molecular basis of this difference is unknown. To determine if α-(1,3)-glucan modulates type I IFN production, we attempted to generate conidia from the G186A ags1Δ strain (66), which is smooth because these cells produce no α-(1,3)-glucan due to a deletion in the α-(1,3)-glucan synthase. However, like many laboratory strains, the ags1Δ strain failed to sporulate (data not shown). No yeast cells from any strains tested, including G217B, G184AR, G184AS, G186AR, and G186AS, were capable of inducing appreciable levels of IFN-β transcript in macrophages (Fig. 3D), again suggesting that production of IFN-β is a specific characteristic of infection with H. capsulatum conidia but not their isogenic yeast cells.

The type I IFN response of BMDMs is independent of MyD88 and TRIF signaling and the adaptor protein MAVS but dependent on IRF3.Canonical production of type I IFNs by macrophages during infection occurs in response to signaling through host Toll-like receptors (TLRs) or a cytosolic nucleic acid detection pathway (42, 77). The induction of IFN-β through either of these pathways is dependent on the transcription factor IRF3. We observed that IFN-β induction during infection with conidia was completely dependent on IRF3 (Fig. 4A), indicating that production of IFN-β transcript during infection with conidia is likely to occur via known pathways.

• Open in new tab
• Download powerpoint

FIG. 4.

The type I IFN response to conidia is dependent on IRF3 and independent of MyD88, TRIF, and MAVS. qRT-PCR was used to determine fold IFN-β induction in irf3^−/− macrophages (A), myd88^−/−trif^−/− macrophages (B), and mavs^+/− and mavs^−/− macrophages (C) infected with G217B conidia at an MOI of 10.

To determine whether host TLR signaling was required for the type I IFN response to conidia, we utilized macrophages from mice lacking TLR adaptor molecules MyD88 and TRIF. myd88^−/−trif^−/− macrophages, which are deficient in TLR signaling, were fully capable of inducing IFN-β in response to infection with G217B conidia (Fig. 4B), suggesting that TLR signaling is not required for IFN-β production by macrophages in response to Histoplasma conidia.

Cytosolic detection of microbial nucleic acids by host cells also results in production of IFN-β. Sensing of RNA by the cytosolic RNA receptors RIG-I and MDA5 requires the innate immune signaling adaptor MAVS, which is required for type I IFN production in response to viral infection (25, 43, 52, 71, 91). Levels of induction of IFN-β transcript by infection with conidia in mavs^−/− and mavs^+/− littermate control macrophages were comparable (Fig. 4C), indicating that cytosolic detection of conidial RNA is unlikely to be responsible for production of IFN-β by host cells. It is currently unknown whether cytosolic sensing of conidial DNA contributes to the type I IFN response.

Phagocytosis is required for IFN-β induction in conidium-infected macrophages.Since TLR signaling is dispensable for IFN-β production in response to conidial infection, our data suggested that cytosolic sensing of a conidial molecule(s) might be required for production of IFN-β by host macrophages. If so, it is likely that phagocytosis of conidia would be necessary to trigger a type I IFN response in macrophages. Macrophages were pretreated with either DMSO (control) or 5 μM actin polymerization inhibitor cytochalasin D (15, 24), infected with G217B conidia, and then subjected to staining as described in Materials and Methods to determine internalization of fungal cells. Cytochalasin-treated macrophages were still associated with conidia but were unable to phagocytose them (Table 1). In contrast to DMSO-treated control cells, cytochalasin-treated macrophages showed a 25-fold reduction in production of IFN-β by qRT-PCR when infected with G217B, suggesting that phagocytosis of conidia is required for the type I response (Table 1). Cytochalasin-treated macrophages exposed to LPS were capable of inducing IFN-β, indicating that the cytochalasin treatment did not generally inhibit IFN-β expression in these cells (data not shown).

Alveolar macrophages induce an interferon-responsive gene in response to infection with conidia but not yeast cells.By probing the transcriptional profile of bone marrow-derived macrophages during infection with conidia or yeast cells, we were able to uncover differential responses elicited in host cells by these two fungal cell types. To perform an initial investigation to determine whether conidia and yeast cells might elicit different responses in a lung macrophage, we isolated alveolar macrophages (AvMs) from 30 mice by BAL. Macrophages were infected with either conidia or yeast cells, and host RNA was harvested at 4 hpi to examine early transcriptional responses. No detectable IFN-β transcript was observed by qRT-PCR during infection of AvMs with either conidia or yeast cells (data not shown). However, we were able to detect a reproducible 6-fold induction of interferon-responsive gene Ifi205 (53) in AvMs infected with conidia but not yeast cells (Fig. 5); Ifi205 was also induced by BMDMs in response to conidia but not yeast cells (see Table S1 in the supplemental material). This experiment supports the idea that conidia and yeast cells could provoke different transcriptional responses in host cells during infection.

• Open in new tab
• Download powerpoint

FIG. 5.

Induction of Ifi205 in AvMs infected with G217B conidia. qRT-PCR analysis to determine fold induction of Ifi205 was performed on AvM samples 4 h after infection with G217B conidia or yeast cells at an MOI of 10. Fold changes are calculated relative to the level in the mock-infected control. Error bars represent the standard error of the mean for replicate qRT-PCRs. The data shown include two (yeast cell A and B) or three (conidia A, B, and C) biological replicates.

Signaling through the type I IFN receptor IFNAR1 contributes to the pathogenesis of H. capsulatum during host infection.The observation that infection with H. capsulatum conidia triggered a type I IFN signature in bone marrow-derived macrophages raises the possibility that type I IFNs could influence the outcome of H. capsulatum infection in the mouse, although the production of type I IFNs in vivo and the cell types that produce them have not been investigated. For other pathogens, examination of the outcome of infection in the ifnar1^−/− mice, which are deficient in the secondary response that results in robust expression of interferon-dependent genes (37, 81), has been used as an initial query to shed light on the role of type I IFN signaling during infection. Interestingly, in response to infection with bacterial pathogens, this type of approach has been used to show that host type I IFN signaling confers either resistance or susceptibility, depending on the bacterial pathogen in question (5, 61, 74). To determine whether type I IFN signaling contributes to the outcome of H. capsulatum infection, we subjected WT and ifnar1^−/− mice to an intranasal infection with 2 × 10⁶ CFU of G217B conidia. Lungs and spleens from infected animals were harvested for enumeration of CFU at 5, 10, and 14 days postinfection (dpi). Whereas the level of fungal burden was not significantly different between the WT and mutant mouse strains at 5 and 10 dpi (based on a P value of ≤0.05), the fungal burden was reproducibly lower in the ifnar1^−/− mice in both the lungs (Fig. 6) and spleen (data not shown) by 14 dpi. These data indicate that signaling through the type I IFN receptor is required for full virulence of Histoplasma conidia.

• Open in new tab
• Download powerpoint

FIG. 6.

Host type I IFN signaling is required for maximal fungal burden in host tissues following infection with H. capsulatum. WT and ifnar1^−/− mice were subjected to intranasal infection with G217B conidia or yeast cells. Two representative conidial infections and one representative yeast cell infection are shown. Lungs from infected animals were harvested at the indicated hours (h) or days (d) postinfection and assessed for CFU. Horizontal bars indicate mean log₁₀ CFU values. Significant P values (P ≤ 0.05) for WT versus ifnar1^−/− comparisons are indicated on the figure.

Since we observed decreased fungal burden in ifnar1^−/− mice at later time points in infection when conidia have germinated to give rise to yeast cells, we were interested to know if infection of wild-type and ifnar1^−/− mutant mice with Histoplasma yeast cells would give a comparable difference in fungal burden. We observed that during mouse infections with H. capsulatum yeasts, the fungal burden was significantly lower in the lungs of ifnar1^−/− mice at 14 dpi (Fig. 6). These data indicate that signaling through the type I IFN receptor is required for maximal disease burden during Histoplasma infection.

Histological examination of lung sections from WT and mutant mice infected with Histoplasma conidia revealed significant differences in the inflammatory infiltrate (Fig. 7). Infected lungs of both WT and ifnar1^−/− mice had a similar pattern of inflammation centered around the bronchioles (Fig. 7A, B, E, and F); however, the lungs of WT mice contained a denser inflammatory infiltrate as well as larger foci of inflammation. Additionally, there were differences in the compositions of the inflammatory infiltrate between the two infected mouse strains (Fig. 7C and D). In WT lungs at 5 dpi, the infiltrate consisted largely of granulocytes and lymphocytes with numerous eosinophils. In contrast, at the same time point, the ifnar1^−/− infiltrate was largely composed of macrophages, with only a minor lymphocytic component. Giant cells, which presumably result from coalescence of infected macrophages, were observed in nearly all the inflammatory foci of WT lungs (Fig. 7C and 8), but were not found in the ifnar1^−/− lungs (Fig. 7D). By 14 dpi, the extent of inflammation had decreased relative to 5 dpi, but was still higher in wild-type mice than in ifnar1^−/− mice (Fig. 7E, F, G, and H). The uninfected lung sections from WT and ifnar1^−/− mice did not look appreciably different (data not shown). Taken together with the CFU data (Fig. 6), these experiments indicate that signaling through the type I IFN receptor is required for the normal extent and character of the inflammatory response to Histoplasma as well as maximal fungal burden in host tissues during Histoplasma infection.

• Open in new tab
• Download powerpoint

FIG. 7.

Wild-type mice have a more extensive inflammatory response to H. capsulatum conidia than ifnar1^−/− mice. Shown are hematoxylin-and-eosin-stained lung sections from mice infected with G217B conidia. Panels A and B are low-power images of representative inflammatory foci at 5 dpi in WT (A) or ifnar^−/− (B) mice. WT inflammatory foci are larger and more densely packed with immune cells. Scale bar, 200 μm. Panels C and D are high-power views of boxed regions from panels A and B. WT infiltrate contains many neutrophils, macrophages and eosinophils, with giant cells (GC) also present. Scale bar, 20 μm. (E and F) Low-power images of representative inflammatory foci at 14 dpi in WT (E) or ifnar^−/− (F) mice. Again, WT mouse inflammatory foci are larger and more densely packed than those of ifnar^−/− mice. Scale bar, 200 μm. Panels G and H are high-power views of boxed regions from panels E and F. The WT shows more densely organized macrophage and lymphocytic inflammation. Scale bar, 20 μm.

• Open in new tab
• Download powerpoint

FIG. 8.

Giant cell formation in conidium-infected lungs of wild-type mice. Shown is high magnification of a giant cell containing H. capsulatum macroconidia (black arrows), microconidia (white arrowheads), and yeast cells (black arrowheads) observed in the lungs of conidium-infected WT mouse strains at 5 dpi. Conidial forms could represent ungerminated cells or conidial remnants that persist after germination. Scale bar, 20 μm.