ABSTRACT
Toxin A (TxA) is able to induce most of the classical features of Clostridium difficile-associated disease in animal models. The objective of this study was to determine the effect of an inhibitor of adenosine deaminase, EHNA [erythro-9-(2-hydroxy-3-nonyl)-adenine], on TxA-induced enteritis in C57BL6 mice and on the gene expression of adenosine receptors. EHNA (90 μmol/kg) or phosphate-buffered saline (PBS) was injected intraperitoneally (i.p.) 30 min prior to TxA (50 μg) or PBS injection into the ileal loop. A2A adenosine receptor agonist (ATL313; 5 nM) was injected in the ileal loop immediately before TxA (50 μg) in mice pretreated with EHNA. The animals were euthanized 3 h later. The changes in the tissue were assessed by the evaluation of ileal loop weight/length and secretion volume/length ratios, histological analysis, myeloperoxidase assay (MPO), the local expression of inducible nitric oxide synthase (NOS2), pentraxin 3 (PTX3), NF-κB, tumor necrosis factor alpha (TNF-α), and interleukin-1β (IL-1β) by immunohistochemistry and/or quantitative reverse transcription-PCR (qRT-PCR). The gene expression profiles of A1, A2A, A2B, and A3 adenosine receptors also were evaluated by qRT-PCR. Adenosine deaminase inhibition, by EHNA, reduced tissue injury, neutrophil infiltration, and the levels of proinflammatory cytokines (TNF-α and IL-1β) as well as the expression of NOS2, NF-κB, and PTX3 in the ileum of mice injected with TxA. ATL313 had no additional effect on EHNA action. TxA increased the gene expression of A1 and A2A adenosine receptors. Our findings show that the inhibition of adenosine deaminase by EHNA can prevent Clostridium difficile TxA-induced damage and inflammation possibly through the A2A adenosine receptor, suggesting that the modulation of adenosine/adenosine deaminase represents an important tool in the management of C. difficile-induced disease.
Clostridium difficile is the most common cause of nosocomial bacterial diarrhea and accounts for 10 to 20% of the cases of antibiotic-associated diarrhea (3, 27). C. difficile infection can result in asymptomatic carriage, mild diarrhea, or fulminant pseudomembranous colitis (31). Increased incidence, severity, and mortality associated with C. difficile infection has been reported worldwide, being the attributable cause of death in up to 6.9% of cases (4, 28). The increased incidence and severity of C. difficile-induced disease has been accredited to the emergence of a new strain called NAP1/BI/027, which has been shown to produce ∼16-fold more toxin A (TxA) and 23-fold more toxin B in vitro (53).
Although a recent report using toxin A or toxin B mutants of C. difficile showed that toxin B, not toxin A, is an essential virulence factor for the development of the disease after infection (35), purified toxin A still is used extensively in animal models of enteritis, since it clearly induces most of the classical features of the disease in animal models. TxA causes intestinal secretion, the destruction of the intestinal epithelium, and hemorrhagic colitis when introduced in vivo to the intestinal lumen (25, 42). The mechanism of TxA-induced enteritis involves toxin binding to enterocyte receptors, leading to the activation of sensory and enteric nerves that results in enhanced intestinal secretion and motility, the degranulation of mast cells, and the infiltration of the mucosa by neutrophils (9, 27, 39). In addition to its proinflammatory and prosecretory activities, TxA induces cell death in human and murine cells, which could contribute to intestinal mucosal disruption (7, 10).
PTX3 is a soluble protein belonging to the pentraxin superfamily that is highly conserved in evolution. Unlike the classical short pentraxins (CRP and SAP), PTX3 is produced locally at the sites of infection and inflammation by a variety of cell types, including fibroblasts, endothelial cells, mononuclear phagocytes, and myelomonocytic dendritic cells, in response to proinflammatory signals, such as tumor necrosis factor alpha (TNF-α), interleukin-1β (IL-1β), and Toll-like receptor agonists (14, 32). Since PTX3 plays a pivotal role in innate resistance to many infectious agents (particularly fungi) (13, 18) and in the orchestration of the inflammatory response (12, 48), in this study we also investigated the involvement of PTX3 in TxA-induced enteritis.
It is well known that the expression of inducible nitric oxide synthase (NOS2) is stimulated in a variety of cells by inflammatory cytokines, such as TNF-α, IL-1β, and gamma interferon (IFN-γ), resulting in the production of high levels of NO, which is involved in the pathogenesis of several inflammatory diseases (26, 33). Because TxA is a potent inducer of inflammatory cytokines, as is shown here, it is reasonable to propose that NO produced by NOS2 has a role in the pathogenesis of TxA-induced damage. Since the role of NO on TxA-induced damage still is ambiguous, we evaluated the expression of NOS2 in murine ileal loops treated with TxA and the effect of EHNA on this expression.
Adenosine is an endogenous purine nucleoside that, following its release from cells or after being formed from the breakdown of nucleotides, diffuses to the plasma membranes of surrounding cells, where it binds to specific cell surface receptors (17, 41). Four types of G protein-coupled adenosine receptors (A1AR, A2AAR, A2BAR, and A3ARs) were identified (17). Although adenosine is constitutively present in the extracellular space at low concentrations, metabolic stress conditions dramatically increase its levels (21).
The binding of adenosine to its receptors on the neutrophil surface may produce either proinflammatory or anti-inflammatory effects, depending on its concentration and the types of receptors stimulated. A1AR engagement induces a proinflammatory response, such as an increase in neutrophil adhesion, recruitment, and phagocytosis. On the other hand, the binding of adenosine to A2AARs results in anti-inflammatory effects, including the decreased neutrophil release of reactive oxygen species (10, 11, 51). A2BAR has a role as a modulator of inflammatory cytokines, adhesion molecules, leukocyte adhesion, and mast cell activation (24, 56). A3AR also is involved in immune function and is particularly important in regulating mast cell function (44, 54). It has been suggested that adenosine enhances the inflammatory response when present in low concentrations. However, at a site where there is significant tissue injury, adenosine is generated in high concentrations by damaged tissues or cells, acting as an inhibitor of neutrophil inflammatory functions (21). Therefore, the overall result of adenosine action is an anti-inflammatory effect due mainly to a dominant A2A response that exceeds the A1 response (11). However, newly formed adenosine is removed very quickly from tissues by adenosine-metabolizing enzymes such as adenosine deaminase (ADA) (1). A previous study from our group has demonstrated that TxA increases ADA activity in murine ileal tissue (10). As blocking adenosine deaminase can elevate the adenosine concentration in biological systems, the objective of this study was to determine the effect of EHNA [erythro-9-(2-hydroxy-3-nonyl)-adenine], an inhibitor of adenosine deaminase, on TxA-induced enteritis in mice and to study the effect of TxA on the gene expression of adenosine receptors.
MATERIALS AND METHODS
Animals.We used 104 male C57BL/6 mice, 25 to 30 g of body weight, from the animal colony of the Federal University of Ceará. The animals received both sterilized water and food ad libitum. All experimental protocols were approved by the local Animal Care and Use Committee.
Drugs and toxins.Purified TxA from Clostridium difficile (strain 10463; molecular mass, 308 kDa) was kindly provided by David Lyerly (Techlab, Blacksburg, VA) and was diluted in phosphate-buffered saline (PBS), pH 7.4; EHNA, [eritro-9-(2-hidroxi-3-nonil)adenine; molecular weight, 313.83; Sigma E114], diluted in PBS plus dimethylsulfoxide (DMSO) and 4-{3-[6-amino-9-(5-cyclopropylcarbamoyl-3,4-dihydroxytetrahydrofuran-2-yl)-9H-purin-2-yl]prop-2-ynyl}piperidine-1-carboxylic acid methyl ester (ATL313), was kindly provided by PGxHealth, LLC (through Adenosine Therapeutics).
EHNA inhibitory action of adenosine deaminase on ileal tissue.Adenosine deaminase activity was assessed by following the method of Giusti (19). Briefly, EHNA (10, 30, or 90 μmol/kg of body weight) or PBS was injected intraperitoneally (i.p.) 30 min before TxA (50 μg) or PBS injection in the ileal loop, and 3 h later the mice were sacrificed and intestinal loops were removed for the evaluation of ADA activity by measuring ammonia resulting from the adenosine deamination.
Induction of intestinal inflammation.Mice were fasted overnight with free access to water and then were anesthetized with ketamine and xylazine (60 and 5 mg/kg intramuscularly, respectively). Through a midline laparotomy, one 4-cm ileal loop was ligated and injected with either 0.1 ml of PBS, pH 7.4 (control), or buffer containing TxA (10 to 100 μg). A dose response was carried out to determine the dose of TxA that caused a significant increase in ileal weight and fluid volume in C57BL/6 mice. The abdomen was closed, and the animals were allowed to regain consciousness. Three hours after the administration of TxA, mice were sacrificed, intestinal loops were removed, and the loop length, weight, and fluid volume were recorded. A portion of the loop was frozen at −70°C for the measurement of myeloperoxidase activity (MPO), and tumor necrosis factor alpha (TNF-α) and interleukin-1β (IL-1β) concentrations were determined by ELISA; another portion was immediately embedded in RNA Later solution for posterior RNA extraction and quantitative reverse transcription-PCR (qRT-PCR) analysis. The remaining tissue was fixed in 10% formalin and processed for histology. Alternatively, mice were injected with EHNA, the adenosine deaminase inhibitor (90 μmol/kg, i.p.), 30 min before the TxA (50 μg) injection in the ileal loop. Some mice pretreated with EHNA were injected with ATL313 (5 nM final concentration) in the ileal loop immediately before the TxA (50 μg) injection.
Histology.The severity of inflammation was scored in coded slides by a pathologist on a scale of 0 (absence of alterations) and 1 (mild) to 3 (severe) for epithelial damage, edema, and neutrophil infiltration as previously described (29, 10). At least six slides were analyzed per group.
Determination of myeloperoxidase activity.The extent of neutrophil accumulation in ileal tissue was estimated by measuring MPO activity as previously described (6). Briefly, 50 to 100 mg of ileal tissue was homogenized in 1 ml of hexadecyltrimethylammonium bromide (HTAB) buffer for each 50 mg of tissue. The homogenate then was centrifuged at 4,000 × g for 7 min at 4°C. MPO activity in the resuspended pellet was assayed by measuring the change in absorbance at 450 nm using o-dianisidine dihydrocloride and 1% hydrogen peroxide. The results were reported as U of MPO/mg of tissue. A unit of MPO activity was defined as the amount of enzyme that converts 1 μmol of hydrogen peroxide to water in 1 min at 22°C.
Quantification of proinflammatory cytokines by ELISA.TNF-α and IL-1β concentrations in ileal tissue were measured by enzyme-linked immunosorbent assay (ELISA) as described previously (43).
Total RNA extraction, reverse transcription, and real-time PCR.Total RNA was isolated from ileum using Trizol reagent (Invitrogen), and 2 μg was reverse transcribed using ImProm-II reverse transcriptase (Promega) and oligo(dT) primer according to the manufacturer's instructions. Real-time RT-PCR (qRT-PCR) was performed on the 7900HT fast real-time PCR system (Applied Biosystems) apparatus using the following specific primers (IDT, Coralville, IA): adenosine receptors A1 (forward, CTGGCTCTGCTTGCTATTGCT; reverse, CGCTGAGTCACCACTGTCTTGTA), A2A (forward, GCTATTGCCATCGACAGATACATC; reverse, TGCCCTTCGCCCTCATAC), A2B (forward, CGACCGATATCTGGCCATTC; reverse, TGTCCCAGTGACCAAACCTTT), and A3 (forward, GGCCATTGCTGTAGACCGATA; reverse, TTCTTCTTTGAGTGGTAACCGTTCT). Also used were primers for PTX3 (forward, GGACAACGAAATAGACAATGGACTT; reverse, CGAGTTCTCCAGCATGATGAAC), IL-1β (forward, TCCACCTCAATGGACAGAATATCA; reverse, GGTTCTCCTTGTACAAAGCTCATG), and TNF-α (forward, CCACGCTCTTCTGTCTACTGAACTT; reverse, TGAGAGGGAGGCCATTTGG). qRT-PCRs, in a final volume of 20 μl, consisted of 10 μl of 2× master mix SYBR green (Applied Biosystems), 10 ng of cDNA, and 5 μl each of forward and reverse primers (concentration from 0.4 to 1.6 μM, in accordance with the gene). PCR assays were performed in duplicate with the following steps: 10 min at 95°C (initial denaturation), 15 s at 95°C and 60 s at 60°C for 40 cycles, and a cooling step to 4°C. The relative gene expression ratios of the TxA-injected samples versus those of the noninjected controls were calculated considering the real-time PCR amplification efficiencies of each pair of primers and the CP (crossing point) as described by Pfaffl (38a). The amplification of the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt) (forward, TGGATATGCCCTTGACTATAATGAGT; reverse, GGCTTTTCCAGTTTCACTAATGACA) was used for the normalization of the data.
Immunohistochemical reaction for NOS2 and NF-κΒ.Immunohistochemistries of NOS2 and NF-κΒ were performed in ileal tissue using the streptavidin-biotin-peroxidase method (23) in formalin-fixed, paraffin-embedded tissue sections (4 μm thick) mounted on poly(l)-lysine-coated microscope slides. The sections were deparaffinized and rehydrated through xylene and graded alcohols. After antigen retrieval, endogenous peroxidase was blocked (15 min) with 3% (vol/vol) hydrogen peroxide and washed in phosphate-buffered saline. Sections were incubated overnight (4°C) with primary rabbit anti-mouse NOS2 (Santa Cruz Biotechnology) or primary rabbit anti-NF-κΒ p50 nuclear localization sequence (NLS; sc-114) (Santa Cruz Biotechnology) antibody diluted 1:400 in PBS plus bovine serum albumin (PBS-BSA). The slides then were incubated with biotinylated goat anti-rabbit or donkey anti-rat IgG and diluted 1:400 in PBS-BSA. After being washed, the slides were incubated with avidin-biotin-horseradish peroxidase conjugate (ABC complex; Santa Cruz Biotechnology) for 30 min according to the Santa Cruz protocol. NF-κΒ and NOS2 were visualized with the chromogen 3,3′diaminobenzidine (DAB). Negative-control sections were processed simultaneously as described above but with the first antibody being replaced by PBS-5% BSA. Slides were counterstained with Harry's hematoxylin.
Statistics.Results are reported as means ± standard errors of the means (SEM) or as median values and ranges, where appropriate. Univariate analysis of variance (ANOVA) followed by Bonferroni's test was used to compare means, and the Kruskal-Wallis test followed by the Dunn's test was used to compare medians. For PCR, one-way ANOVA followed by Newman-Keuls multiple comparison was used. A probability value of P < 0.05 was considered significant.
RESULTS
EHNA inhibitory action on adenosine deaminase activity on ileal tissue.Systemic pretreatment with EHNA (30 and 90 μmol/kg) significantly (P < 0.05) reduced ADA activity in the ileal tissue (PBS, 2.968 ± 0.4532; EHNA at 90 μmol/kg, 0.3491 ± 0.07186 μmol NH3/mg protein/h) (Fig. 1A). The dose of 90 μmol/kg of EHNA also reduced significantly (P < 0.05) the TxA-induced increase in ADA activity on ileal tissue (TxA, 9.067 ± 3.299 μmol NH3/mg protein/h; EHNA and TxA at 90 μmol/kg, 2.274 ± 0.574 μmol NH3/mg protein/h) and was adopted for the following experiments (Fig. 1B).
Effect of EHNA on adenosine deaminase (ADA) activity in murine ileum tissue. EHNA (10, 30, 90 μmol/kg) or PBS was injected i.p. 30 min before the injection of PBS (A) or TxA (50 μg) (B) in the ileal loop. Three hours later, the mice were sacrificed and intestinal loops were removed for the evaluation of ADA activity by the Giusti method. Bars on the graphs represent the ADA-specific activity (μmol of NH3/mg of protein/h) in the ileum tissue as means ± standard errors of the means (SEM) (n = 5 to 6). *, P < 0.05 compared to the control (PBS); **, P < 0.05 compared to the group pretreated with PBS and injected with TxA into the loop. ANOVA with Bonferroni's correction was used.
Effect of Clostridium difficile TxA in murine ileal loops.To evaluate the inflammatory and secretory effects of TxA in murine ileal loops, we observed enteritis in responses to increasing amounts of TxA (10, 20, 50, and 100 μg), measuring both loop weight and the accumulation of fluid in the intestinal lumen as endpoints. TxA induced a significant (P < 0.05) increase of ileal weight/length and volume/length ratios at 50 and 100 μg compared to results for the PBS controls (Fig. 2 A and C). The dose of 50 μg was adopted for the following experiments.
Effect of Clostridium difficile TxA on ileal loop weight and secretion volume. Ileal loops were injected with 0.1 ml of TxA (10, 20, 50, or 100 μg/loop) or phosphate-buffered saline (PBS) (A and C). Alternatively, mice received systemic pretreatment with EHNA (90 μmol/kg, i.p.) or PBS 30 min prior to the local injection of TxA (50 μg/loop) or PBS (B and D). A group of mice pretreated with EHNA were injected with ATL313 (5 nM final concentration) in the ileal loop immediately before TxA (50 μg). Three hours after the administration of TxA and PBS, mice were sacrificed. Weight/ileal loop length (mg/cm) (A and B) and secretion volume/ileal loop length (μl/cm) (C and D) are presented as means ± SEM (n = 6 to 9). *, P < 0.05 compared to the control group (PBS); **, P < 0.05 compared to group pretreated with PBS and injected with TxA into the loop. ANOVA with Bonferroni's correction was used.
Effect of EHNA on murine ileal loops injected with Clostridium difficile TxA.Pretreatment with EHNA, the adenosine deaminase inhibitor (90 μmol/kg, i.p.), significantly (P < 0.05) but not completely reduced the TxA (50 μg/loop)-induced increase in weight/ileal loop length (TxA, 73.24 ± 5.68 mg/cm; EHNA plus TxA, 54.62 ± 4.98 mg/cm; Fig. 2B) and secretion volume/ileal loop length ratios (TxA, 39.26 ± 5.30 mg/cm; EHNA plus TxA, 27.05 ± 4.39 mg/cm; Fig. 2D). ATL313 did not increase the effect of EHNA in weight/ileal loop length and secretion volume/ileal loop length ratios. In the absence of TxA, EHNA (90 μmol/kg, i.p.) did not affect weight/ileal loop length or secretion volume/ileal loop length ratios (Fig. 2B and D).
Histological analysis demonstrated that TxA (50 μg/loop), as expected, induced intense mucosal disruption, hemorrhage, edema, and inflammatory cell infiltration, resulting in a median injury score of 3 and a range of 2 to 3 (Fig. 3 B), while the control group, injected with PBS, presented a median score of 0 (0 to 0) (Fig. 3A). The median score of the group pretreated with EHNA was 1 (range, 0 to 2), which was a significant (P < 0.05) reduction of the disruptive effects of TxA compared to results for the PBS-pretreated control group (Fig. 3C). However, three out of six animals in the EHNA-plus-TxA group still presented discrete mucosal disruption, hemorrhage, edema, and inflammatory cell infiltration (score of 1), and one animal presented a moderate histological alteration (score of 2). The ileal mucosa was normal in mice that received only EHNA without TxA (Fig. 3D).
Effect of EHNA on Clostridium difficile TxA-induced histological alterations. (A) Histological status when ligated ileal loops were treated with PBS only. (B) Mucosal disruption in ligated ileal loop injected with TxA (50 μg/loop). (C) Substantial prevention of mucosal disruption induced by TxA when the mouse was pretreated with EHNA (90 μmol/kg i.p.). (D) Normal aspect of the ileal mucosa of animal pretreated with EHNA (90 μmol/kg i.p.) without TxA. Hematoxylin and eosin staining was used; magnification, ×100.
We assessed neutrophil infiltrates by measuring myeloperoxidase activity in the ileal tissue (6). MPO is an enzyme present in the azurophil granules of neutrophils, and its activity has been used to indicate the neutrophil infiltration of the tissues (6). TxA (50 μg/loop) caused a statistically significant increase (P < 0.05) in MPO activity in ileal tissue compared to data for the loops from the control group, which were injected only with PBS (TxA, 21.07 ± 4.15 U/mg; PBS, 3.82 ± 0.75 U/mg). The group pretreated with EHNA and then challenged with TxA had markedly reduced MPO activity (P < 0.05) (EHNA plus TxA, 8.78 ± 1.81 U/mg; TxA, 21.07 ± 4.15U/mg) (Fig. 4).
Effect of EHNA on Clostridium difficile TxA-induced myeloperoxidase (MPO) activity. The mice received systemic pretreatment with EHNA (90 μmol/kg i.p.) or PBS 30 min prior to the local injection of TxA (50 μg/loop) or PBS. Three hours later, mice were euthanized and the intestinal loops were removed and frozen (−70°C) for the measurement of MPO activity. Bars on the graph represent the MPO activity (U/mg) as means ± standard error of means (SEM) (n = 6 to 7). *, P < 0.05 compared to control group (PBS); **, P < 0.05 compared to control group pretreated with PBS and injected with TxA into the loop. ANOVA with Bonferroni's correction was used.
Effect of EHNA on Clostridium difficile TxA-induced pro- and anti-inflammatory cytokines.The injection of TxA (50 μg/loop) into mouse ileal loops significantly increased the local tissue production of both TNF-α and IL-1β (P < 0.05) compared to that of the control group (PBS). Pretreatment with EHNA significantly (P < 0.05) reduced TxA-induced TNF-α (PBS and TxA, 1,767 ± 249.9 pg/ml; EHNA plus TxA, 1,054 ± 26.61 pg/ml; Fig. 5A) and IL-1β (PBS and TxA, 4,307 ± 346.4 pg/ml; EHNA plus TxA, 2,430 ± 289.9 pg/ml; Fig. 5B) production in ileal tissue compared to that of loops injected with TxA in animals pretreated with PBS. This reduction also was accompanied by the significant downmodulation of the transcripts for these cytokines in the ileum of EHNA-pretreated mice (Fig. 6 A and B).
Effect of EHNA on Clostridium difficile TxA-induced increase of concentration of cytokines. The mice received systemic pretreatment with EHNA (90 μmol/kg i.p.) or PBS 30 min prior to the local injection of TxA (50 μg/loop) or PBS. Three hours later, mice were euthanized and the intestinal loops were removed for cytokine assay by ELISA. Bars on the graph represent TNF-α and IL-1β content (means ± SEM; n = 5 to 7). *, P < 0.05 compared to control group (PBS); **, P < 0.05 compared to the group pretreated with PBS and with TxA injected into the loop. ANOVA with Bonferroni's correction was used.
Effect of EHNA on Clostridium difficile TxA-induced gene expression for cytokines and pentraxin 3 (PTX3). The mice received systemic pretreatment with EHNA (90 μmol/kg i.p.) or PBS 30 min prior to the local injection of TxA (50 μg/loop) or PBS. Three hours later, mice were sacrificed, and the intestinal loops were removed for gene expression analysis by qRT-PCR. Graphs represent the expression ratios of TNF-α, IL-1β, and PTX3 mRNAs obtained from TxA-injected ileum relative to the controls injected with PBS (means; n = 6). *, P < 0.05 compared to control group (PBS); **, P < 0.05 compared to the TxA group. ANOVA was used with the Newman-Keuls test.
Effect of EHNA on Clostridium difficile TxA-induced NOS2 expression.Immunohistochemical staining for NOS2 was significantly (P < 0.05) increased in ileal tissue of mice treated with TxA compared to levels for PBS-injected mice. The TxA-induced expression of NOS2 was significantly (P < 0.05) decreased by the pretreatment of the animals with EHNA (PBS plus PBS, 11 ± 2.23 cells/fields; PBS and TxA, 129.2 ± 11.65 cells/fields; EHNA plus TxA, 58.50 ± 4.88 cells/fields; Fig. 7). No immunostaining for NOS2 was found in the negative control (ileum tissue incubated in the absence of anti-mouse NOS2 antibody) (Fig. 7E).
Effect of EHNA on Clostridium difficile TxA-induced increase in immunostaining for inducible nitric oxide synthase (NOS2). (A) Ileal tissue of animal treated with PBS (control). (B and C) Increased number of cells immunostained for NOS2 (stained brown) in the ligated ileal loop injected with TxA (50 μg/loop). (D) Substantial prevention of TxA-induced NOS2 expression in animals pretreated with EHNA. (E) Negative control (ileal tissue not treated with NOS2 antibody). The graph represents means ± SEM of the number of cells immunostained/field. Magnification, × 400.
Effect of EHNA on Clostridium difficile TxA-induced NF-κB expression.Increased immunostaining for the NF-κB-p50 NLS (which specifically binds to the dissociated fraction p50 of NF-κB in the nucleus or in the cytoplasm) was detected in ileal tissue of mice with TxA-induced enteritis (Fig. 8 B) but not in PBS-injected mice (Fig. 8A) and was paralleled by a TxA-promoted increase in cytokine gene expression (Fig. 6A and B). Moreover, the immunostaining for NF-κB-p50 NLS was substantially reduced by the pretreatment of the animals with EHNA (Fig. 8C), which was accompanied by the drastic downmodulation of the cytokines gene expression shown in Fig. 6A and B. No immunostaining for NF-κB was found in the negative control (ileal tissue incubated in the absence of anti-NF-κB-p50 NLS antibody) (Fig. 8D).
Effect of EHNA on Clostridium difficile TxA-induced increase in immunostaining for NF-κB-p50 NLS. (A) Ileal tissue of animal treated with PBS only. (B) Increased number of cells immunostained for NF-κB-p50 NLS (stained brown) in the ligated ileal loop injected with TxA (50 μg/loop). Arrows identify cells with immunostained nuclei. (C) Substantial prevention of TxA-induced NF-κB-p50 NLS immunostaining in animals pretreated with EHNA. (D) Negative control (ileal tissue not treated with NF-κB-p50 NLS antibody). Magnification, ×400. Smaller micrographs represent areas with a magnification of ×1,000.
Effect of EHNA on Clostridium difficile TxA-induced Ptx3 expression.We also investigated the participation of the long pentraxin 3 (PTX3) in TxA-induced enteritis based on our previous findings pointing out the pivotal role of this protein in injury following intestinal ischemia and reperfusion (49, 50). TxA promoted an increase in Ptx3 gene expression in ileal tissue of mice with TxA-induced enteritis compared to that of PBS-injected mice (Fig. 6C). Moreover, EHNA drastically downmodulated the pentraxin gene expression shown in Fig. 6C.
Effect of Clostridium difficile TxA in the presence or absence of EHNA on adenosine receptor gene expression.TxA promoted an increase in A1 and A2A adenosine receptor gene expression (Fig. 9 A and B) but did not alter the expression of A2B and A3 receptors (Fig. 9C and D). Moreover, the pretreatment with EHNA reduced toxin A-induced A1 and A2A adenosine receptor gene expression, but this effect did not reach statistical significance (Fig. 9A and B).
Effect of Clostridium difficile TxA with or without EHNA on adenosine receptor gene expression. The mice received systemic treatment with EHNA (90 μmol/kg i.p.) or PBS 30 min prior to the local injection of TxA (50 μg/loop) or PBS. Three hours later, mice were sacrificed, and the intestinal loops were removed for gene expression analysis by qRT-PCR. Graphs represent the expression ratios of A1 (A), A2A (B), A2B (C), and A3 (D) adenosine receptor mRNAs obtained from TxA-injected ileum relative to the controls injected with PBS (means; n = 4 to 5). *, P < 0.05 compared to the control group (PBS). ANOVA was used with the Newman-Keuls test.
DISCUSSION
During inflammatory and ischemic episodes, endogenous adenosine is produced and acts as a protective metabolite. Newly formed adenosine, however, is removed very quickly from tissues by adenosine-metabolizing enzymes, ADA, and adenosine kinase. Previous studies from our laboratory showed that TxA increased adenosine deaminase activity in ileal tissue (10). ADA is an important deaminating enzyme that converts adenosine and 2′deoxyadenosine to inosine and 2′-deoxyinosine, respectively (52). In this study, we tested the anti-inflammatory effect of EHNA, a potent and reversible inhibitor of the enzyme adenosine deaminase 1, which has been shown to be less toxic than other ADA inhibitors, because it preserves the cellular capacity for the deamination of purines (1). Using a method previously described (19), we determined the EHNA inhibitory action on ADA activity in ileal tissue, and based on a dose-response curve, we chose the dose of 90 μmol/kg to perform the experiments with TxA. Our in vivo data showed that EHNA considerably reduced the mucosal disruption and inflammation induced by TxA in the mouse ileal loop. Consistently with our findings, it has been demonstrated that the elevation of endogenous adenosine concentrations through the inhibition of adenosine kinase by GP515 downregulates local inflammation in a model of dextran sulfate sodium (DSS)-induced colitis (46). It also has been reported that adenosine has a potent anti-inflammatory effect, mainly through activation of its A2A and A2B receptors, leading to a reduction in cytokine production, inflammatory cell infiltration, and cell damage (5, 11, 15, 21). These anti-inflammatory effects of adenosine could provide an explanation for the effects of EHNA reported herein.
We also report herein that TxA increased the expression of A1AR and A2AAR in ileal tissue without modulating the expression of A2BAR and A3AR, and that the pretreatment with EHNA reduced TxA-induced A1AR and A2AAR gene expression, but this effect did not reach statistical significance. Our results suggest that the anti-inflammatory effect of EHNA relies on the ability to enhance the concentration of adenosine in the ileal tissue following TxA challenge, affecting more modestly the expression of the adenosine receptors. It is unlikely that pretreatment with EHNA is interfering with TxA binding to its receptor, since EHNA was administered systemically by i.p. injection and the toxin was administered directly in the ileal loop. We also have found that EHNA injected systemically (i.p.) 1 h after the local (intraloop) administration of TxA abolished the TxA-induced increase in MPO activity (data not shown).
The binding of adenosine to its receptors on the neutrophil surface may produce either proinflammatory or anti-inflammatory effects, depending on its concentration and the types of receptors stimulated. A1AR engagement induces a proinflammatory response, such as an increase in neutrophil adhesion, recruitment, and phagocytosis. On the other hand, the binding of adenosine to A2AARs results in anti-inflammatory effects, including the decreased neutrophil release of reactive oxygen species (10, 11, 51). It is suggested that adenosine enhances the inflammatory response when present in low concentrations (21). Here, we used an adenosine deaminase inhibitor, EHNA, to enhance the concentration of adenosine in the ileal tissue challenged with TxA. Previous studies have shown that adenosine in high concentrations has an anti-inflammatory effect, mainly due to a dominant A2A response that exceeds the A1 response (11). Our group previously has demonstrated that an adenosine A2AR agonist (ATL313), in the absence of EHNA, almost completely abolishes the TxA-induced increase in weight/ileal loop length and secretion volume/ileal loop length ratios and reduced TxA-induced mucosal disruption, cell death, TNF-α release, and inflammatory cell infiltration. We now show that in the presence of EHNA, the effects of ATL313 are much weaker than when the agonist is used alone, which indicates that most of the anti-inflammatory effects of EHNA observed in our model rely on its ability to enhance the concentration of adenosine in the ileal tissue that maximally stimulates A2A receptors.
The abundant presence of neutrophils within TxA-induced pseudomembranes is well known (9, 34), as is their important role in the pathogenesis of ileal damage induced by C. difficile TxA (2, 27). Here, we showed that EHNA reduced TxA-induced MPO activity, suggesting a potent effect of EHNA to inhibit neutrophil infiltration into ileal tissue. Thus, it is reasonable to propose that, at least in part, the protective effects of EHNA are related to this inhibitory effect, since the activation of A2AAR has been reported to inhibit neutrophil diapedesis (20, 56).
It has been shown that TxA induces the release of cytokines, such as TNF-α and IL-1β, that contribute to the pathogenesis of TxA-induced colitis (8, 16). Our findings confirmed the data showing that TxA induces gene expression and leads to the synthesis of TNF-α and IL-1β in the mouse ileum. The data presented here demonstrated that the inhibition of adenosine deaminase by EHNA reduced the production of both cytokines in the ileum in response to TxA. It has been shown that adenosine reduces the release of TNF-α by mouse peritoneal macrophages via A2AR and A2BR (30) and of IL-1β by human monocytes via A1R, A2AR, and A3R (47). Furthermore, a previous study from our group showed that an adenosine A2AR agonist significantly reduced TxA-induced TNF-α synthesis in the mouse ileal loop (10). The increased expression of A1R and A2AR in ileal tissue of animals treated with TxA and EHNA could be an explanation for the inhibitory effect of EHNA on cytokine production, which may have a critical implication for its preventive action on neutrophil infiltration and tissue damage. This inhibitory effect on cytokine production might be due to the suppression of the NF-κB pathway promoted by the activation of the A2A receptor (45). Our data showing the decreased expression of NF-κB-p50 NLS in the ileal tissue of mice treated with EHNA supports this hypothesis.
Our results clearly show an increased expression of NOS2 in ileal tissue of mice treated with TxA. The role of NO on TxA-induced damage still is ambiguous. Melo Filho and coworkers reported that TxA and TxB did not induce the production of NO by macrophages in vitro, and that the use of an inhibitor of NOS (L-NIO) did not modify the cellular damage induced by these toxins (37). On the other hand, TxB has been shown to promote the increased expression of NOS2 by inactivating the G protein of the Rho family (22, 38). Qiu and coworkers demonstrated that inhibitors of NOS, L-NAME and 7-NI, caused an increase in TxA-induced secretion and mannitol permeability in rat ileal loops. These effects were observed only when L-NAME and 7-NI were administered before, but not after, TxA. These findings suggest an inhibitory action of L-NAME and 7-NI on constitutive rather than inducible NOS, because the latter is upregulated several hours after the onset of acute inflammation. Moreover, a more selective NOS2 inhibitor, aminoguanidine, had no effect on TxA-induced secretion and permeability (40). It is well known that the expression of NOS2 is induced in a variety of cells by inflammatory cytokines such as TNF-α, IL-1β, and IFN-γ, resulting in the production of high levels of NO, which are involved in the pathogenesis of several inflammatory diseases (26, 33). Since TxA is a potent inducer of inflammatory cytokines, as has been shown here, it is reasonable to propose that NO produced by NOS2 has a role in the pathogenesis of TxA-induced damage. Here, we also demonstrated that the inhibition of adenosine deaminase by EHNA reduced TxA-induced NOS2 expression. In accordance with our findings, other studies have revealed that adenosine A2BR, A1R, and A3R agonists also reduce the expression of NOS2 (36, 55).
In the current study, we demonstrated for the first time that TxA upmodulates pentraxin 3 expression in the ileum of mice. Previously, in a model of intestinal ischemia and reperfusion, we showed that Ptx3 overexpression led to a higher mortality rate correlated with increased inflammation, intestinal damage, and augmented levels of TNF-α, IL-1β, and CxCL1(KC) (50), while in Ptx3 knockout mice tissue injury was markedly inhibited and lethality prevented (49). Our findings suggest that Ptx3 is among the mediators of the pathogenesis of TxA-induced colitis and that pentraxin is a potential serological marker of tissue inflammation and damage in C. difficile-induced disease. The reduction of Ptx3 local levels promoted by EHNA may be related to the reduced ileal inflammation seen in EHNA-pretreated animals.
In conclusion, the present study reports that EHNA, an inhibitor of adenosine deaminase 1, significantly reduces C. difficile TxA-induced mouse ileal secretion, edema, inflammatory cell infiltration, mucosal disruption, TNF-α and IL-1β production, and NOS2 expression, presumably by augmenting the availability of adenosine to act through its receptors that promote the transduction of anti-inflammatory signals. In addition, we report that pentraxin 3 also is involved in TxA-induced inflammation, and that its expression is downregulated by EHNA.
These findings suggest a role for adenosine/adenosine deaminase in the pathogenesis of C. difficile-induced disease. These data are particularly important in light of recent reports of the increased incidence and severity of C. difficile-induced disease and the need for the additional clarification of its pathogenesis and new therapeutic strategies.
ACKNOWLEDGMENTS
We gratefully acknowledge Ricardo Renzo Brentani for the critical review of the manuscript and Maria Silvandira F. Pinheiro and José Ivan R. de Sousa for technical assistance.
This work was supported by a grant from Conselho Nacional de Pesquisa (CNPq) number 472019/2007-4.
FOOTNOTES
- Received 26 April 2010.
- Returned for modification 5 October 2010.
- Accepted 12 November 2010.
- Accepted manuscript posted online 29 November 2010.
- Copyright © 2011, American Society for Microbiology
