Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Infection and Immunity
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About IAI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Molecular Pathogenesis

The Bordetella avium BAV1965-1962 Fimbrial Locus Is Regulated by Temperature and Produces Fimbriae Involved in Adherence to Turkey Tracheal Tissue

Stewart B. Loker, Louise M. Temple, Andrew Preston
A. J. Bäumler, Editor
Stewart B. Loker
1Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Louise M. Temple
2Department of Integrated Science and Technology, James Madison University, Harrisonburg, Virginia 22807
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Andrew Preston
1Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: a.preston@bristol.ac.uk
A. J. Bäumler
Roles: Editor
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/IAI.01169-10
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    Schematic diagram of the genetic organization of the B. avium chromosome spanning fhaC-BAV1966, and the sizes (in base pairs) of the DNA regions in between the predicted coding sequences of each gene. Where no size is given, the adjacent coding sequences have overlapping start and stop codons.

  • Fig. 2.
    • Open in new tab
    • Download powerpoint
    Fig. 2.

    RT-PCR analysis of transcription of the B. avium BAV1962-1965 fimbrial locus. RT-PCR products were separated by agarose electrophoresis on a 1.5% gel and stained with ethidium bromide. L, 100-bp DNA ladder. Templates: lane 1, B. avium genomic DNA positive control; lane 2, negative control. No template: RNA from bacteria grown at 22°C (lane 3) or 37°C (lane 4), without reverse transcription, and cDNA reverse transcribed from RNA from bacteria grown at 22°C (lane 5) or 37°C (lane 6).

  • Fig. 3.
    • Open in new tab
    • Download powerpoint
    Fig. 3.

    Transmission electron micrographs of B. avium cells negatively stained with ammonium molybdate. Putative fimbria-like cell surface appendages (highlighted by arrows) were observed on WT bacteria grown at 37°C (A) or 22°C (B). Flagella were observed only on WT bacteria grown at 22°C (C). Immunostaining of bacteria with anti-BAV1965 antiserum and colloidal gold particles revealed immunoreactive material on WT bacteria grown at 37°C (D and E) but not on a BAV1965-1962 deletion mutant (F) or WT bacteria grown at 22°C (data not shown). Due to space constraints, images representative of many are shown.

Tables

  • Figures
  • Table 1.

    Sequences of primers used in this study

    PrimerLeft sequenceRight sequence
    Fimbrial locus knockout
        BAV1962-1965 upstream5′ATCAGGAAGTTCTGAATAGAGCA3′5′GCAAGCTTGTAAGGAATCAAAG3′
        BAV1962-1965 downstream5′CCTGGGATTTCTCTCAACG3′5′ATGGCCTTCCTCTTTCAAAT3′
    RT-PCR
        tyrB cDNA5′GCTTCAAAGTCGAAACCTACAC3′5′GGTTAGATTGCGTGTTGTAGCTG3′
        BAV1965 cDNA5′GATCACTATTCGCGGTGAAATC3′5′GCCAGGCTCAAAATAAATATGG3′
        BAV1964 cDNA5′CTCTCTCGGCCTGGTATTTCTT3′5′AAAGGGCACCTCCATTTGAT3′
        BAV1963 cDNA5′TGTCTTATAGCAAGACCCTGGA3′5′GAGAGATAGAGGCTGCCGTAAC3′
        BAV1962 cDNA5′GGGAGTTGTTCAGTCATGTCAC3′5′GAATCCGTAGTTCTCCAGTTGC3′
    BAV1965 expression construct5′TTCATATGACCATGCATACGATCAAAAAA3′5′TTGAATTCTCAGGGGTACATGACAGAGAA3′
  • Table 2.

    Homologues of the B. avium putative fimbrial proteinsa

    ProteinClosest homologue(s)Amino acid identity (%)Conserved domain(s)
    BAV1965BB3425/FimNBB48pfam00419
    BB2992/FimABB47Fimbrial protein
    BAV1964BB2991/FimBBB52pfam00345, pfam02753, Gram-negative pilus assembly
    BAV1963BB2990/FimCBB46pfam00577, fimbrial usher
    BAV1962BB2989/FimDBB25pfam00419, fimbrial protein
    BAV1773BB235428COG3539
    BB033821FimA pilin protein
    BAV1774BB2990/FimCBB30pfam00577, fimbrial usher
    BAV1775BB2991/FimBBB34pfam00345, Gram-negative pilus assembly
    BAV1776STM0200/fimbrial protein—Salmonella typhimurium, LT228pfam00419, fimbrial protein
    BAV1777BB3426/FimXBB, BB3425/FimNBB, BB2991/Fim2BB, BB1658/Fim3BB27pfam00419, fimbrial protein
    • ↵a B. avium fimbrial biogenesis proteins were subject to BLASTP analysis and conserved domain analysis. BB, B. bronchiseptica.

  • Table 3.

    Relative quantification of BAV1965 expression at 22°C and 37°C using the 2−ΔΔCT method

    TempCTΔCTaΔΔCTbNormalized BAV1965 amtc
    BAV1965tyrB
    22°C22.0614.11
    21.8814.15
    22.0813.93
    Avg22.01 ± 0.1114.06 ± 0.127.94 ± 0.210.00 ± 0.211.00 (0.87–1.16)
    37°C17.4815.87
    17.9215.88
    17.6215.90
    Avg17.67 ± 0.2315.88 ± 0.021.79 ± 0.22−6.15 ± 0.2271.18 (60.967–83.097)
    • ↵a ΔCT = (avg CT, BAV1965 − avg CT, tyrB).

    • ↵b ΔΔCT = (avg ΔCT, target − avg ΔCT, 22°C).

    • ↵c BAV1965 amount (2−ΔΔCT) was normalized relative to the amount at 22°C. Values in parentheses indicate 95% confidence intervals.

  • Table 4.

    Adherence of WT and B. aviumΔ1965-1962 to turkey tracheal ring cultures

    StrainFraction of inoculum adheredSD
    WT0.03650.0251
    B. avium Δ1965-19620.00830.0049a
    B. avium Δ1965-1962(pBBR1fim)0.03450.0212
    B. avium Δ1965-1962(pBBR1)0.00500.0016a
    • ↵a Significantly different (P < 0.05) from values for either WT or the deletion mutant complemented by carriage of BAV1965-1962 on a plasmid (pBBR1fim) as calculated by Student's t test.

PreviousNext
Back to top
Download PDF
Citation Tools
The Bordetella avium BAV1965-1962 Fimbrial Locus Is Regulated by Temperature and Produces Fimbriae Involved in Adherence to Turkey Tracheal Tissue
Stewart B. Loker, Louise M. Temple, Andrew Preston
Infection and Immunity May 2011, 79 (6) 2423-2429; DOI: 10.1128/IAI.01169-10

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Infection and Immunity article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
The Bordetella avium BAV1965-1962 Fimbrial Locus Is Regulated by Temperature and Produces Fimbriae Involved in Adherence to Turkey Tracheal Tissue
(Your Name) has forwarded a page to you from Infection and Immunity
(Your Name) thought you would be interested in this article in Infection and Immunity.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
The Bordetella avium BAV1965-1962 Fimbrial Locus Is Regulated by Temperature and Produces Fimbriae Involved in Adherence to Turkey Tracheal Tissue
Stewart B. Loker, Louise M. Temple, Andrew Preston
Infection and Immunity May 2011, 79 (6) 2423-2429; DOI: 10.1128/IAI.01169-10
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • INTRODUCTION
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

About

  • About IAI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #IAIjournal

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0019-9567; Online ISSN: 1098-5522