Article Figures & Data
Figures
- Fig 1
L. monocytogenes strain LO28 hyperinduces the macrophage production of IFN-β during cytosolic infection. RT-qPCR analysis of IFN-β (A) and IL-1β (B) induction in macrophages infected with the indicated strains at 4 h postinfection, with MOIs of ∼0.5 to 3.0 (see Materials and Methods for the normalization procedure). *, statistical difference in induction compared to induction by strain 10403S using Student's t test (P ≤ 0.05); **, P ≤ 0.01. (C and D) Analysis of IFN-β induction, as in panel A, in WT and myd88−/− trif−/− macrophages (C) or irf3−/− macrophages (D). **, statistical difference in induction in irf3−/− macrophages compared to induction in WT macrophages (P ≤ 0.01). All experiments were performed on 3 biological replicates.
- Fig 2
Strain LO28 contains naturally occurring mutations in the brtA gene. (A) ClustalW alignment of the brtA gene from strains EGDe, LO28, and 10403S. Red shading indicates nucleotides not conserved between strains. The dashed line in the brtA gene in strain LO28 denotes the 188-bp deletion in this strain. Blue shading indicates the first stop codon in the brtA gene in each strain. (B) Schematic of the LMO2588 to LMO2589 region of the 10403S and LO28 genomes. Black arrows represent predicted promoters.
- Fig 3
IFN-β hyperinduction by strain LO28 results from constitutive mdrT derepression. (A) RT-qPCR analysis of mdrT expression in the indicated strains during mid-log-phase growth in BHI medium. *, statistical difference in mdrT expression compared to expression in strain 10403S using Student's t test (P ≤ 0.05); **, P ≤ 0.01. (B) Kinetics of mid-log-phase growth of the indicated strains in BHI medium, as measured by the OD600. Strains were back-diluted every 2 h (see Materials and Methods). (C) Kinetics of growth of the indicated strains during cytosolic infection of macrophages, as measured by a standard gentamicin protection assay. (D) RT-qPCR analysis of IFN-β induction in macrophages 4 h postinfection. *, statistical difference in IFN-β induction compared to induction by strain LO28 using Student's t test (P ≤ 0.05). All experiments were performed on 3 biological replicates.
- Fig 4
Overexpression of MdrT decreases strain LO28 virulence in the liver, independent of IFN-β hyperinduction. WT (A) and ifnar−/− (B) mice were infected i.v. with 1 × 104 CFU of the indicated strains. Bacterial abundance in the specified organs was determined 2 days postinfection. Black bars represent the median values. *, statistical difference in bacterial burden compared to that in mice infected with LO28 using Student's t test (P ≤ 0.05); **, P ≤ 0.01. Ten-mouse cohorts were used for each infection.
- Fig 5
Overexpression of MdrT in strain LO28 causes increased bile tolerance. Stationary-phase cells of the indicated genotypes were serially diluted and then spotted on BHI agar with and without supplementation with 1% porcine bile. Colony growth was visualized after 24 h at 37°C.
- Fig 6
Overexpression of MdrT reduces LO28 virulence in the gastrointestinal tract and gallbladder. (A) WT mice were infected i.v. with 1 × 104 CFU of the indicated strains, and bacterial abundance in the gallbladder was determined 4 days postinfection. **, statistical difference in bacterial burden compared to that in mice infected with LO28 using Student's t test (P ≤ 0.01); ND, no CFU detected. (B) WT mice were infected intragastrically with 1 × 1010 CFU of the indicated strains of L. monocytogenes, and kanamycin-resistant bacteria were enumerated in the feces at the indicated days postinfection. Black bars represent median values. No statistically significant differences in numbers of bacterial CFU were observed. Five-mouse cohorts were used for each infection.
Tables
- Table 1
Strains and primers used in this study
Strain, plasmid, or primer Relevant characteristic(s), description, or purpose Sequencea Reference or source L. monocytogenes strains 10403S Serotype 1/2a 12 F6854 Serotype 1/2a 9 FSL J2-064 Serotype 1/2b 14 LO28 Serotype 1/2c 3 FSL J1-208 Serotype 4a 40 Aureli Serotype 4b 2 F2365 Serotype 4b 23 H7858 Serotype 4b 10 EGDe Serotype 1/2a 13 LO28 ΔmdrT LO28 with in-frame deletion of mdrT This study LO28 + pIMK-BrtA LO28 with integrated WT (10403S) allele of BrtA This study LO28 + pIMK LO28 with integrated empty pIMK plasmid This study LO28 ΔmdrT + pIMK LO28 ΔmdrT with integrated empty pIMK plasmid This study Plasmids pKSV7 ΔmdrT Temperature-sensitive plasmid for allelic exchange (deletion) of mdrT 11 pIMK Site-specific integration plasmid 24a pIMK-BrtA pIMK containing WT (10403S) allele of BrtA under its own promoter This study Primers 5′ (BamHI) BrtA Clones BrtA into pIMK integration vector AAAAGGATCCACTTCCATGGTAAGGAAGGGGTCG 3′ (NotI) BrtA Clones BrtA into pIMK integration vector AAAAGCGGCCGCTTATAAAAGCCCGTTCACACAAGCTTC IFN-β for RT-qPCR analysis GCACTGGGTGGAATGAGACTATTG IFN-β rev RT-qPCR analysis TTCTGAGGCATCAACTGACAGGTC IL-1β for RT-qPCR analysis GACCTGTTCTTTGAAGTTGACGG IL-1β rev RT-qPCR analysis TGTCGTTGCTTGGTTCTCCTTG β-actin for RT-qPCR analysis TGGCATTGTTACCAACTGGGACG β-actin rev RT-qPCR analysis GCTTCTCTTTGATGTCACGCACG MdrT for RT-qPCR analysis CCCCAACCATCATTACCCGCTGAACTAAATCCGTATAG MdrT rev RT-qPCR analysis GGTTGGATTGTGGATTCGTATGATTGGCGCG 16S for RT-qPCR analysis ACGGCTAACTACGTGCCAG 16S rev RT-qPCR analysis ATGACCCTCCCCGGTTAAG ↵a Underlining indicates added restriction sites.
- Table 2
Genes most upregulated in strain LO28 during intracellular growth compared to their expression in strain 104030Sa
Fold increase in expressionb (log2) ORFc Gene name Annotation 4.7 LMO0049 agrD Similar to S. aureus agrD 4.6 LMO0152 Similar to oligopeptide ABC transporter-binding protein 4.5 LMO2588 mdrT Major facilitator superfamily multidrug efflux pump 4.5 LMO0204 actA Actin assembly protein 4.3 LMO0048 agrB Similar to S. aureus agrB 4.1 LMO2064 Similar to large-conductance mechanosensitive channel protein 4.1 LMO1809 plsX Fatty acid/phospholipid synthesis 4.0 LMO0903 osmC OsmC family protein 3.9 LMO1472 dnaJ Heat shock protein 3.5 LMO0135 ctaX Similar to oligopeptide ABC transporter system substrate-binding protein 3.5 LMO2433 estA Acetylesterase 3.4 LMO0137 Similar to oligopeptide ABC transporter, permease protein ↵a The listed genes are among those determined to be statistically significantly differentially expressed by the Significance Analysis of Microarrays plug-in with a false discovery rate of 1% (see Materials and Methods).
↵b In strain LO28 compared to that in strain 104030S.
↵c ORF, open reading frame.
Supplemental material
Files in this Data Supplement:
- Supplemental file 1 -
Table S1. Macrophage infection conditions to achieve similar MOIs.
PDF file, 21K.
- Supplemental file 1 -
Table S1. Macrophage infection conditions to achieve similar MOIs.
