Article Figures & Data
Figures
- Fig 1
Genetic organization and enzymatic activities of RelA-SpoT family proteins in B. pseudomallei and cell morphology of RelA-SpoT family mutants. (A) Schematic overview of the chromosomal regions surrounding the relA gene (BPSL1946 [top]) and the spoT gene (BPSL2561 [bottom]). Predicted promoters and their linear discriminant function (LDF) score are indicated. (B) Schematic of the classical synthesis pathway of (p)ppGpp. pppGpp is produced from GTP and ATP by either RelA- or SpoT-dependent mechanisms and is subsequently converted to ppGpp. ppGpp interacts directly with the RNA polymerase enzyme (RNAP) and thus affects gene expression. The effects of ppGpp induction are relieved by SpoT-mediated hydrolysis of ppGpp. (C to E) Cell morphology of B. pseudomallei wild-type strain K96243 (C), a K96243 ΔrelA single mutant (D), and a K96243 ΔrelA ΔspoT double mutant (E). All strains were grown to early stationary growth phase (24-h incubation at 37°C) in LB broth, and bacterial cells were visualized by bright-field microscopy at a magnification of ×100. The scale bars represent the average length of K96243 wild-type cells. In panel E, two images of K96243 ΔrelA ΔspoT mutant cells are presented, one focused on single cells (left) and one focused on a filament (right).
- Fig 2
Growth and stationary-phase survival of wild-type K96243 and isogenic mutants. All strains were inoculated into LB broth at an optical density of 0.01, and cultures were incubated at 37°C with aeration. (A) Growth curve representing the optical densities of the cultures at the indicated time points. (B) Stationary-phase survival of the strains determined by plating samples onto LB agar plates at the indicated time points. All experiments were performed in at least three independent experiments, and data are plotted on a logarithmic scale as means with standard deviations (A) or standard errors of the means (B) for those experiments.
- Fig 3
Intracellular survival of wild-type K96243 and isogenic mutants. J774A.1 murine macrophages were infected with wild-type K96243 and isogenic mutants at an MOI of 10, and intracellular bacterial numbers were determined at the indicated time points after initial infection by plating onto LB agar plates. Bars and error bars represent the means and standard deviations of a representative experiment performed in three technical replicates for each time point.
- Fig 4
Killing of G. mellonella larvae by wild-type K96243 and isogenic mutants. (A) Groups of 10 larvae per strain were injected with 1 × 104 CFU of bacteria and maintained at 37°C. Dead and live larvae were scored at indicated time points and plotted as Kaplan-Meier survival curves. All curves were significantly different from each other (log rank test; P < 0.01 in all cases). (B) The number of bacteria present inside the larvae at 20 h postinfection was determined by aseptically removing the bottom 2 mm of five larvae per strain, draining the hemocoel, and plating serial dilutions onto LB agar plates. Results are means and standard deviations from two independent experiments.
- Fig 5
Survival and protection of mice infected with wild-type K96243 and its isogenic ΔrelA ΔspoT mutant. (A and B) C57BL/6 mice were challenged intranasally with an intended dose of 2,500 CFU (acute challenge [A]) or 500 CFU (chronic challenge [B]). Actual infection doses for each experiment are given in parentheses. Log rank tests confirmed a significant difference in survival between the wild type and the ΔrelA ΔspoT mutant in both cases (P < 0.001 and P < 0.05, respectively). (C to E) C57BL/6 mice were immunized intranasally with 1 × 105 CFU of strain 2D2 or K96243 ΔrelA ΔspoT. After 5 weeks of incubation, mice were challenged intranasally with 1,000 CFU of B. pseudomallei strain 576. Mice were monitored for survival, and numbers are plotted as Kaplan-Meier survival curves (C). Log rank tests confirmed a significant difference in survival of the K96243 ΔrelA ΔspoT and the 2D2 cohorts compared to the saline control (P < 0.01 and P < 0.05, respectively). At day 55 after infection with the wild type, bacterial burdens were assessed in lungs (D) and spleens (E) of survivors. Note that only one mouse had survived up to this time point in the saline-treated sample group. The spleen of this mouse and that of one survivor in the K96243 ΔrelA ΔspoT sample group had extremely large abscesses and could not be harvested. N.A., not available.
Tables
- Table 1
Strains and plasmids used in this study
Strain or plasmid Description Reference B. pseudomallei strains K96243 Clinical isolate from Thailand 23 K96243 ΔrelA Inactivation of BPSL1946 (relA) by complete deletion This study K96243 ΔrelA ΔspoT Inactivation of BPSL1946 (relA) and BPSL2561 (spoT) by complete deletion This study 576 Clinical isolate from Thailand 2 2D2 Auxotroph transposon mutant of B. pseudomallei 576 3 E. coli strains DH5 Δpir recA1 gyrA (Nal) Δ(lacIZYA-argF) (ϕ80dlacΔ[lacZ]M15) pirRK6 43 S17-1 Δpir RPA-2 tra regulon; pirRK6 Smr Tpr 43 Plasmids pDM4 Suicide vector with R6K origin; Cmr 29 pDM4-ΔrelA 600 bp up- and downstream of relA cloned into pDM4 via XhoI/SphI sites This study pDM4-ΔspoT 600 bp up- and downstream of spoT cloned into pDM4 via SalI/XmaI sites This study - Table 2
Oligonucleotides used in this study
Name Sequence (5′–3′)a Purpose relA-1-fw CCCCTCGAGGAAGGCGCGCGGACAAGCGG Mutagenesis relA-2-rv CGGCGCTCACTGCAGCATCGTCGGGTATGGCCAGTT Mutagenesis relA-3-fw CCGACGATGCTGCAGTGAGCGCCGCCGGTGGGCCGC Mutagenesis relA-4-rv CCCGCATGCCGTATCGACGAGTTCGCCGTC Mutagenesis spoT-1-fw GCGGTCGACCTGCCGCCGTCGCTCGCGGC Mutagenesis spoT-2-rv GCGGCGCTAACTAGTCATTTTCGCCTCCTGGGTTCG Mutagenesis spoT-3-fw GCGAAAATGACTAGTTAGCGCCGCGCGGCGCCCGAC Mutagenesis spoT-4-rv GCGCCCGGGGCCTGCGCGAAATCGAGGTCG Mutagenesis relA-up-fw ACAACGGCACCGTCTATCTC Confirmation of plasmids relA-down-rv GCGGTGTCATAACCGTATTC Confirmation of plasmids spoT-up-fw CTCGCATTACCGTTGAAGAC Confirmation of plasmids spoT-down-rv GCCCTTTCAGTTCGAAGTTG Confirmation of plasmids relA-3-fw GCGTGCAGTCGGACCTGCTG Confirmation of mutation relA-4-rv GTTCGGGAAAATTCGCAAGCC Confirmation of mutation relA-5-wt GTGGAAGCGGAATCGGCTG Confirmation of mutation spoT-3-fw GGTGAAGAAGCAGTTCCGCA Confirmation of mutation spoT-4-rv CGCCCGAAACAAATGGCGG Confirmation of mutation spoT-5-wt GCGGACGATGGTGTAGTGC Confirmation of mutation relA-RT-1 AGATCCGCACGCAGGAAATG RT-PCR analysis relA-RT-2 TTCGCTGTGCAGGTGGTAAG RT-PCR analysis spoT-RT-1 GCGCATCAATGGCTCAAGTC RT-PCR analysis spoT-RT-2 TTCAGGCGCATCGTCTTCAG RT-PCR analysis 16S-RT-1 GCCAGTCACCAATGCAGTTC RT-PCR normalization 16S-RT-2 ACCAAGGCGACGATCAGTAG RT-PCR normalization ↵a Restriction sites are underlined. Complementary regions are in italics. Translational start and stop codons are in bold.
