ABSTRACT
Cutaneous leishmaniasis, caused mainly by Leishmania major, an obligate intracellular parasite, is a disfiguring disease characterized by large skin lesions and is transmitted by a sand fly vector. We previously showed that the chemokine receptor CXCR3 plays a critical role in mediating resistance to cutaneous leishmaniasis caused by Leishmania major. Furthermore, T cells from L. major-susceptible BALB/c but not L. major-resistant C57BL/6 mice fail to efficiently upregulate CXCR3 upon activation. We therefore examined whether transgenic expression of CXCR3 on T cells would enhance resistance to L. major infection in susceptible BALB/c mice. We generated BALB/c and C57BL/6 transgenic mice, which constitutively overexpressed CXCR3 under a CD2 promoter, and then examined the outcomes with L. major infection. Contrary to our hypothesis, transgenic expression of CXCR3 (CXCR3Tg) on T cells of BALB/c mice resulted in increased lesion sizes and parasite burdens compared to wild-type (WT) littermates after L. major infection. Restimulated lymph node cells from L. major-infected BALB/c-CXCR3Tg mice produced more interleukin-4 (IL-4) and IL-10 and less gamma interferon (IFN-γ). Cells in draining lymph nodes from BALB/c-CXCR3Tg mice showed enhanced Th2 and reduced Th1 cell accumulation associated with increased neutrophils and inflammatory monocytes. However, monocytes displayed an immature phenotype which correlated with increased parasite burdens. Interestingly, transgenic expression of CXCR3 on T cells did not impact the outcome of L. major infection in C57BL/6 mice, which mounted a predominantly Th1 response and spontaneously resolved their infection similar to WT littermates. Our findings demonstrate that transgenic expression of CXCR3 on T cells increases susceptibility of BALB/c mice to L. major.
INTRODUCTION
Leishmaniasis affects over 12 million people worldwide and, according to recent estimates, almost 2 million people are affected annually (1). It is therefore a major global health problem and has been classified by the World Health Organization as a neglected tropical disease. The most common form of the disease is cutaneous leishmaniasis (CL), which is caused by Leishmania major, Leishmania tropica, or Leishmania aethiopica in the Old World and by Leishmania mexicana species complex or Leishmania (Viannia) braziliensis species complex in the New World. CL is characterized by the development of large papular or nodular lesions at the infection site, which often become ulcerated and may persist for months or even years. In some patients, lesions can become chronic, leading to disfiguring mucosal leishmaniasis. There are currently no vaccines available for the disease, and resistance to first-line drugs is becoming increasingly common (2, 3).
In murine models of CL, it is well established that protective host immunity depends on the generation and recruitment of appropriate Th1 immune cells to the site of infection. The hallmark of Th1 responses is the production of gamma interferon (IFN-γ), which activates mononuclear phagocytes, increases the production of reactive nitrogen species (RNS), and enhances parasite killing (4, 5). CXCR3 is a chemokine receptor which is preferentially expressed on Th1 cells and activated CD8+ T cells and coordinates their recruitment to inflammatory sites where they exert their effector function. CXCR3 is regulated by the transcription factor T-bet, a master regulator of Th1 responses. CXCR3 has been shown to be important in immunity to intracellular parasites which require a Th1 immune response for protection, including L. major. Genetic deletion of cxcr3 in C57BL/6 (BL/6) mice, which are naturally resistant to L. major, renders them susceptible to localized infection. Although these mice are able to generate a Th1 immune response in the draining lymph nodes, they are unable to control parasite growth in the lesion due to defective CD4+ and CD8+ T cell migration to the site of infection (6). More recent studies have shown that BALB/c (BC) mice, which are genetically susceptible to L. major, are unable to efficiently express CXCR3 on their T cells despite their ability to produce amounts of IFN-γ-producing T cells comparable to those produced by resistant BL/6 mice (7). Although numerous factors have been shown to govern genetic susceptibility of BC mice to L. major, including their inability to upregulate interleukin-12 receptor β2 (IL-12Rβ2) (8), more recent studies indicate that the intrinsic deficiency in upregulating CXCR3 upon activation might contribute to susceptibility of these mice. However, it is not known whether compensating for this deficiency through transgenic expression of CXCR3 in BC T cells would confer resistance to these mice against L. major infection.
Transgenic mouse models have been used in the study of gene function and have significantly enhanced our understanding of numerous elements of the immune system (9–11). Transgenic gene expression in T cells has been successfully utilized to further characterize the function of genes associated with the immune response in various disease models (12–22). In this study, we generated and characterized BALB/c and C57BL/6 T cell-specific CXCR3 transgenic (CXCR3Tg) mice and analyzed immune responses generated against L. major infection. Our novel T cell-specific CXCR3 transgenic mouse lines provide useful tools in clarifying the role of CXCR3 in various infectious, autoimmune, and neoplastic disease models.
MATERIALS AND METHODS
Generation of CXCR3 transgenic mice.Mouse CXCR3 cDNA from a C57BL/6 background was kindly provided by Bao Lu (Harvard Medical School, Boston MA). A 1.1-kb fragment was generated from the cDNA template containing the CXCR3 gene with EcoRI sites incorporated into the flanking regions of the PCR product. Using these restriction enzyme sites, the CXCR3 PCR fragment was cloned into the VA CD2 vector. The resulting 15-kb plasmid was checked for correct insertion of the CXCR3 cDNA cassette by restriction digest analysis, and the plasmid sequence was confirmed by DNA sequencing. Large-scale preparation of the CXCR3Tg targeting vector (TV) plasmid DNA was performed using a Qiagen Plasmid Maxi Kit (Qiagen, Valencia, CA) and linearized by digestion with NotI restriction endonuclease. The targeting vector was run on a 0.8% agarose gel, excised, gel purified using a Qiagen gel extraction kit (Qiagen, Valencia, CA), and eluted with 20 μl of clean, sterile, DNase-free microinjection buffer (10 mM Tris-HCl, 0.25 mM EDTA, pH 8.0). The size, concentration, purity, and integrity of the targeting vector DNA were verified by agarose gel analysis and spectrophotometry. The CXCR3Tg TV was sent to Brigham and Women's Hospital's Transgenic Mouse Facility for microinjection into pronuclei of C57BL/6 embryos and reimplantation into pseudopregnant females. Resulting litters were transferred to The Ohio State University Animal Facility, where they were screened for integration of the CXCR3 transgene.
Screening of CXCR3 transgenic mice.CXCR3Tg mice were screened using either Southern blotting or PCR. For Southern blot screening, genomic DNA from mouse tails was digested using HindIII. A PCR-generated 630-bp digoxigenin (DIG)-labeled probe (Roche Applied Science, Indianapolis, IN) was used for hybridization of membrane-containing DNA. Detection of the hybridized probe was performed using the substrate CSPD (Roche Applied Science, Indianapolis, IN). Chemiluminescence was detected after exposure to a FluorChem HD2 chemiluminescent imaging system (ProteinSimple, Santa Clara, CA).
For PCR screening, two primer sets were used for detection of the CXCR3 transgene. Primer set 1 consisted of P1 (CGTCATCTTCACGGAGAGAA), P2 (TGTTGACCACATGGCTGAGT), and P3 (CAGACAGAATGTGGCAGGAA). Primer set 2 consisted of P4 (TCGTAGGGAGAGGTGCTGTT), P5 (GCGCTCTTGCTCTCTGTGTA), and P6 (GGTCACCTTCCCAGTCTGAGT). Genomic DNA from mouse tails was prepared and used as the template for the PCR. The PCR was performed according to the following cycling conditions: 95°C for 3 min; 35 cycles of 94°C for 40 s, 48°C for 40 s, and 68°C for 1 min; 68°C for 10 min; and a hold at 4°C.
Mouse strains.C57BL/6 CXCR3Tg mice were bred with C57BL/6 wild-type (WT) (Harlan Laboratories, Indianapolis, IN) mice to generate BL/6 CXCR3Tg and BL/6 CXCR3+/+ (wild-type littermates) mice. C57BL/6 CXCR3Tg mice were also backcrossed to the BALB/c background by breeding with WT BALB/c (Harlan Laboratories, Indianapolis, IN) mice for 10 generations to generate BC CXCR3Tg and BC CXCR3+/+ (wild-type littermates) mice. All mice were maintained in a pathogen-free animal facility at The Ohio State University in accordance with NIH and institutional guidelines.
Parasites.L. major (LV39) parasites were maintained by serial passage of amastigotes into the footpads of BC mice. Amastigotes isolated from infected lesions were grown to stationary phase in M199 medium supplemented with 10% fetal calf serum (FCS) (Atlanta Biologicals, Flowery Branch, GA), 100 μg/ml streptomycin, and 100 U/ml penicillin (Invitrogen, Carlsbad, CA), as described previously (23).
Leishmania infection protocol and parasite enumeration.Infectious metacyclic promastigotes at doses of 2.0 × 106 parasites were inoculated into the left hind footpad of CXCR3Tg and CXCR3+/+ mice. Progression of the lesion was monitored using a dial-gauge micrometer (Mitutoyo, Tokyo, Japan) by measurement of the left footpad thickness in comparison with the uninfected contralateral hind footpad. Parasite loads in infected footpads were determined by limiting dilution assay in complete Schneider's insect medium (Invitrogen, Carlsbad, CA), as described previously (23, 24).
Histoplasma infection.CXCR3+/+ and CXCR3Tg mice were infected intranasally with a sublethal inoculum (2 × 105) of yeasts of Histoplasma strain G217B. Mice were sacrificed at day 8, and single-cell suspensions from lungs were analyzed for T cell infiltration by flow cytometry.
DNFB contact hypersensitivity challenge.CXCR3+/+ and CXCR3Tg mice were sensitized with 0.5% 2,4-dinitrofluorobenzene (DNFB) as described previously (25) and then challenged 6 days later on the ear dermis with 0.2% DNFB. After 24 h postchallenge, ear thickness was measured using a dial-gauge micrometer (Mitutoyo, Tokyo, Japan) and compared to the thickness of the unchallenged ear. Subsequently, mice were sacrificed, and mouse ear dorsal and ventral dermal sheets were separated and incubated, dermal side down, in culture medium containing 2 mg/ml of collagenase A and 0.5 mg/ml DNase I for 2 h at 37°C and then passed through a 70-μm-pore-size strainer to obtain single-cell suspensions. Infiltrating T cells were stained with CD4 and CD8 antibodies and analyzed by flow cytometry using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA).
Cytokine ELISA.Cells from draining lymph nodes were isolated from infected CXCR3+/+ and CXCR3Tg mice and plated at a concentration of 0.3 × 106 cells per well in duplicates in sterile 96-well tissue culture plates. Cells were stimulated with freeze-thawed L. major antigen (20 μg/ml). Supernatants were harvested after a 72-h incubation and analyzed for the production of IL-4, IL-10, and IFN-γ by enzyme-linked immunosorbent assay (ELISA) (Biolegend, San Diego, CA).
Flow cytometry.Single-cell suspensions were prepared from draining lymph nodes of infected CXCR3+/+ and CXCR3Tg mice and stained with antibodies against T cell, neutrophil, and macrophage markers, including CD3, CD4, CD8, CD11b, Gr1, F4/80, Tim3, and ST2 (Biolegend, San Diego, CA). For intracellular staining, cells were restimulated with phorbol 12-myristate 13-acetate (PMA) and ionomycin (Sigma-Aldrich, St. Louis, MO) in the presence of brefeldin A for 6 h and then stained with fluorescently labeled CD3 and CD4 antibodies. Cells were then fixed, permeabilized, and stained with anti-IL-4 and -IFN-γ antibodies (BD Biosciences, San Jose, CA). Cells were acquired in a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA) and analyzed using FlowJo software (Tree Star, Inc.).
Statistical analysis.Student's unpaired t test was used to determine the significance of differences between data sets. P values of <0.05 were considered statistically significant.
RESULTS
Generation of T cell-specific CXCR3 transgenic mice.We designed a CXCR3 transgenic targeting vector (CXCR3Tg TV) by inserting the mouse CXCR3 cDNA into a human CD2 minigene-based vector for T cell-specific expression in transgenic mice (26) (Fig. 1A). A Southern blot strategy was designed to determine integration of the targeting vector into mouse genomic DNA after microinjection of linearized CXCR3Tg TV into the pronuclei of C57BL/6 embryos and reimplantation into pseudopregnant females. As shown in Fig. 1B, 2 mice (15.3%) were positive for the 1.2-kb transgene fragment after Southern blot analysis of genomic DNA obtained from mouse tails (Fig. 1B). The mouse with a higher copy number (n = 7) of the transgene was used for subsequent breeding. The resulting T cell-specific CXCR3 transgenic mice (BL/6 CXCR3Tg) were viable and healthy with no phenotypic defects. In order to generate a T cell-specific CXCR3 transgenic L. major-susceptible model, BL/6 CXCR3Tg mice were backcrossed for 10 generations by breeding with WT BALB/c mice to generate BALB/c T cell-specific CXCR3 transgenic mice (BC CXCR3Tg). Finally, we designed a PCR strategy to genotype progeny mice that contained the CXCR3 transgene and allowed for quicker identification of CXCR3Tg mice. PCR results showed a 295-bp CXCR3Tg band or a 558-bp wild-type (CXCR3+/+) band for primer set 1 and a 402-bp CXCR3Tg band or a 267-bp CXCR3+/+ band for primer set 2 (Fig. 1C).
Generation of CXCR3Tg mice. (A) CXCR3Tg targeting vector and strategy for Southern blot detection of transgenic clones. A targeting vector coding for the cxcr3 gene driven by the human CD2 promoter was injected into fertilized eggs of C57BL/6 mice. (B) Southern blot screening of genomic DNA from mice obtained from reimplanted embryos containing the CXCR3 transgene. Numbers at the top of the blot represent individual mice. Mouse 833 was used for the generation of the transgenic line. (C) PCR screening of genomic DNA from CXCR3Tg and CXCR3+/+ mice using two separate primer pairs. PCR products were electrophoresed on a 1% agarose gel. Arrows depict transgenic bands. WT, CXCR3+/+; Tg, CXCR3Tg. (D) Flow cytometric analysis of cells isolated from the thymus, lymph nodes, and spleens of BC CXCR3+/+, BL/6 CXCR3+/+, BC CXCR3Tg, and BL/6 CXCR3Tg mice stained with CD3, CD4, CD8, and CXCR3 antibodies. Numbers represent percentages of CXCR3-expressing T cells. Cells are gated on CD4+ and CD8+ T cells. Results are representative of three separate experiments with similar results.
Analysis of CXCR3 expression in T cell-specific CXCR3 transgenic mice.As demonstrated from previous work by us and others, CXCR3 is expressed in only a very small percentage of T cells in the spleen and lymph nodes of naive mice (7, 27) and is usually restricted to memory or innate T cell subsets (28). Our CXCR3Tg TV construct was designed for constitutive and optimal expression of CXCR3 in all T cells (26). We therefore confirmed whether CXCR3 protein is expressed constitutively in all T cells of CXCR3Tg mice. Single-cell suspensions from spleens of BL/6 CXCR3+/+ and BL/6 CXCR3Tg mice were prepared and stained with fluorescently labeled anti-CD3 and anti-CXCR3 antibodies and then analyzed by flow cytometry. Analysis of T cells from spleens of BC CXCR3Tg and BL/6 CXCR3Tg mice showed expression of CXCR3 by virtually all T cells (Fig. 1D). Our data also confirm enhanced CXCR3 expression in T cells in spleens and lymph nodes of BL/6 WT mice compared to BC WT mice (7) (Fig. 1D). Further, phenotypic analysis of BC and BL/6 CXCR3Tg mice did not reveal any defect in the functions and proportions of lymphocytes in the spleen and lymph nodes compared to CXCR3+/+ mice (data not shown).
Next, we determined whether T cells from CXCR3Tg mice were able to migrate efficiently in response to CXCR3 ligands. We used 2,4-dinitrofluorobenzene (DNFB) as a model of contact hypersensitivity, which induces the production of CXCR3 ligands at the challenge site (29), thereby providing a suitable model to test T cell migration in vivo. We observed significantly increased ear thickness in DNFB-challenged CXCR3Tg mice over CXCR3+/+ mice (Fig. 2A). This was accompanied by increased CD4+ and CD8+ T cell migration to DNFB-challenged ears in CXCR3Tg mice compared to CXCR3+/+ mice as revealed by flow cytometric analysis (Fig. 2B). To further demonstrate the functionality of CXCR3-expressing T cells in CXCR3Tg mice, we analyzed T cell migration into the lungs of CXCR3Tg and CXCR3+/+ mice infected with the fungus Histoplasma capsulatum. We previously showed that CXCR3-expressing T cells significantly increase lung infiltration after 8 to 10 days of H. capsulatum infection (30). At day 8 postinfection, the percentage of CD8+ T cells recruited to the lungs of CXCR3Tg mice increased by about 5 times compared to levels in CXCR3+/+ mice (Fig. 2C). Finally, we characterized CXCR3 expression and migration in T cells of BC CXCR3Tg mice. Similar to results for BL/6 CXCR3Tg mice, CXCR3 was expressed in virtually all T cells of BC CXCR3Tg mice and showed no defects in T cell migration (Fig. 2D). Taken together, our data show that CXCR3 is expressed in all T cells of BC CXCR3Tg and BL/6 CXCR3Tg mice and that transgenic expression of CXCR3 in T cells of BL/6 and BC mice in our model results in enhanced migration of T cells in response to inflammatory signals that induce CXCR3 ligands in vivo.
Phenotypic characterization of CXCR3Tg mice. (A) Ear thickness measurements of DNFB-challenged CXCR3+/+ and CXCR3Tg mice. Data shown are means ± standard errors of the means of results from experiments with 3 or 4 mice per group and are representative of two separate experiments with similar results. **, P < 0.01 using an unpaired t test. (B) Flow cytometric analysis of CD4+ and CD8+ populations migrating to the ear pinnae of BL/6 CXCR3+/+ and BL/6 CXCR3Tg mice following DNFB challenge. Numbers represent percentages of the total cells in the gated population. (C) Flow cytometric analysis of migrating CD8+ T cell populations in lung infiltrates of BL/6 CXCR3+/+ and BL/6 CXCR3Tg mice challenged with a sublethal dose of H. capsulatum. (D) Flow cytometric evaluation of CXCR3 expression in BC CXCR3+/+ and BC CXCR3Tg mice in draining lymph nodes following challenge with L. major parasites. All plots shown are representative data from at least two separate experiments, involving 5 to 10 mice per group, with similar results.
Transgenic expression of CXCR3 in T cells of C57BL/6 mice has no effect on the outcome of L. major infection.Using knockout mouse models, CXCR3 has been shown to be critical for resistance to L. major in BL/6 mice (6). Interestingly, only a small percentage of CD4+ T cells express CXCR3 during L. major infection (7). L. major infection in the BL/6 mouse background often resolves but is characterized by the development of a transient lesion. We therefore hypothesized that transgenic expression of CXCR3 would increase resistance to L. major in this background. To investigate this, BL/6 CXCR3Tg mice and BL/6 CXCR3+/+ littermates were infected with L. major, and footpad measurements were taken weekly. Contrary to our hypothesis, the course of infection was not altered in BL/6 CXCR3Tg mice (Fig. 3A) as no significant differences in lesion sizes developed between BL/6 CXCR3Tg and BL/6 CXCR3+/+ mice. Parasite load assays conducted at the conclusion of the experiment detected no parasites in infected lesions. We further compared the immune responses generated by BL/6 CXCR3Tg and BL/6 CXCR3+/+ mice against infection by L. major. Lymph node cells of infected mice restimulated by L. major antigen ex vivo yielded no detectable differences in the production of IFN-γ, IL-4, and IL-10 by BL/6 CXCR3+/+ and BL/6 CXCR3Tg mice (Fig. 4A to C). Taken together, our results show that transgenic expression of CXCR3 in T cells of C57BL/6 mice does not increase resistance against CL caused by L. major infection.
Effect of transgenic T cell expression of CXCR3 on lesion growth of CL in BL/6 and BC mice. Footpad lesion measurements of CXCR3+/+ and CXCR3Tg mice infected with L. major in C57BL/6 (A) and BALB/c (B) backgrounds. (C) Parasite burden quantification in BC CXCR3+/+ and BC CXCR3Tg mice as determined by parasite dilution assay. Data represent means ± standard errors of the means of results of experiments with 9 or 10 mice per group and are representative of two separate experiments with similar results. **, P < 0.01; ***, P < 0.001 (Student's unpaired t test).
Cytokine profiles of BALB/c and C57BL/6 CXCR3Tg mice infected with L. major. (A to C) Concentrations of IFN-γ, IL-4, and IL-10 produced by cells isolated from draining lymph nodes of L. major-infected BL/6 mice restimulated with L. major antigen as determined by cytokine ELISA. (D to F) Concentrations of IFN-γ, IL-4, and IL-10 produced by cells isolated from draining lymph nodes of L. major-infected BALB/c mice restimulated with L. major antigen as determined by cytokine ELISA. Data represent means ± standard errors of the means of results from duplicates using 5 to 10 individual mice per group and are representative of two independent experiments with similar results. *, P < 0.05; **, P < 0.01 (Student's unpaired t test).
Transgenic expression of CXCR3 in T cells increases susceptibility of BC mice to CL caused by L. major.Unlike WT BL/6 mice, BC mice are genetically susceptible to L. major infection. Previous work from our laboratory (7), coupled with data from our current study (Fig. 2D), shows that BC mice have a deficiency in upregulating CXCR3 during L. major infection. BC CXCR3Tg mice therefore provide a more suitable model to examine the effect of transgenic CXCR3 expression on resistance to L. major. Since these mice correct for the deficiency in CXCR3 upregulation genetically associated with the BC background, we hypothesized that transgenic T cell expression of CXCR3 in BC mice will increase resistance to L. major. We examined our hypothesis by infecting BC CXCR3Tg mice and BC CXCR3+/+ littermates with L. major in their footpads and analyzing the course of infection over a period of 10 weeks. As expected, BC CXCR3+/+ mice developed progressive lesions and were unable to control parasite growth (Fig. 3B). However, contrary to our hypothesis, BC CXCR3Tg mice displayed increased lesion sizes by week 6 postinfection compared to BC CXCR3+/+ mice, which was maintained up to week 10 (Fig. 3B). Moreover, parasite dilution assays showed that lesions in BC CXCR3Tg mice contained significantly more parasites than BC CXCR3+/+ littermates (Fig. 3C). Our results clearly indicate that transgenic expression of CXCR3 in T cells of BC mice increases susceptibility to L. major infection.
L. major-infected BC CXCR3Tg mice display increased Th2 and reduced Th1 cytokines.To determine possible mechanisms behind the increased susceptibility of BC CXCR3Tg mice to L. major infection, we analyzed cytokine production by draining lymph node cells of infected BC CXCR3+/+ and BC CXCR3Tg mice restimulated ex vivo by L. major antigen. BC CXCR3Tg mice produced significantly reduced amounts of IFN-γ, a Th1 cytokine critical for protection against L. major, compared to BC CXCR3+/+ mice (Fig. 4D). Production of the Th2-associated cytokine IL-4 and the anti-inflammatory cytokine IL-10 was significantly elevated in CXCR3Tg mice compared to levels in CXCR3+/+ littermates (Fig. 4E and F). These results suggest that transgenic expression of CXCR3 in T cells of BC mice contributes to decreased Th1 and increased Th2 cytokine production during L. major infection, which is associated with susceptibility in these mice.
Flow cytometric analysis on cells isolated from the draining lymph nodes of infected BC CXCR3Tg and BC CXCR3+/+ mice further supports a mechanism of increased Th2 polarization and reduced Th1 polarization in L. major-infected BC CXCR3Tg mice. Intracellular staining of CD4+ T cells of infected mice revealed a trend toward lower production of IFN-γ in BC CXCR3Tg mice although differences were not statistically significant (Fig. 5A and C). Further, expression of Tim3, a marker for Th1 cells, was significantly reduced in CD4+ T cells of BC CXCR3Tg mice compared to levels in BC CXCR3+/+ mice (Fig. 5F). Conversely, the percentage of IL-4-producing cells was slightly increased in L. major-infected BC CXCR3Tg mice compared to amounts in L. major-infected BC CXCR3+/+ mice (Fig. 5B and D). A similar trend was observed in the expression of the Th2-specific surface marker ST2 in CD4+ T cells of these mice (Fig. 5G). Ratios of total Th1 to Th2 cells further support a more polarized Th2 response and a decreased Th1 immune response in BC CXCR3Tg mice (Fig. 5E and H). Taken together, our data suggest that enhanced Th2 polarization and reduced Th1 cytokine production contribute to the increased susceptibility of BC CXCR3Tg mice to L. major infection.
Th1 and Th2 responses of L. major-infected BALB/c CXCR3Tg mice. (A) Intracellular flow cytometric analysis of IFN-γ-producing CD4+ T cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. Plots are representative data of experiments with 3 mice per group with similar results. (B) Intracellular flow cytometric analysis of IL-4-producing CD4+ T cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. Plots are representative data from experiments with 3 mice per group with similar results. (C) Percentages of IFN-γ-producing CD4+ T cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. (D) Percentages of IL-4-producing CD4+ T cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. (E) Ratio of total IFN-γ- to IL-4-producing T cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice based on intracellular staining with IFN-γ and IL-4 antibodies. (F) Percentages of Th1 cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. Cells were stained with Tim3 antibody, and data are presented as percentages of CD4+ cells. (G) Percentages of Th2 cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. Cells were stained with ST2 antibody, and data are presented as percentages of CD4+ cells. (H) Ratio of total Th1 to Th2 cells in lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice based on Tim3 and ST2 antibody staining. All graphs represent means ± standard errors of the means of results of experiments with three individual mice per group. **, P < 0.01, using Student's unpaired t test.
Transgenic expression of CXCR3 in T cells inhibits monocyte maturation during L. major infection of BALB/c mice.Alterations in the cytokine profiles of infected CXCR3Tg mice led us to examine whether other leukocytes involved in the immune response to L. major were affected, which could affect susceptibility to CL. Analysis of myeloid-derived populations revealed an increased accumulation of neutrophils and inflammatory monocytes in the lymph nodes of BC CXCR3Tg mice infected with L. major compared to levels in BC CXCR3+/+ mice (Fig. 6A to C). These populations are hosts for Leishmania parasites, and neutrophil accumulation has been shown to contribute to the development of a Th2 response and subsequent susceptibility to L. major (31). Further analysis of infiltrating monocytes in the draining lymph nodes showed a diminished level of monocyte maturation in infected BC CXCR3Tg mice relative to BC CXCR3+/+ littermates, as shown by lower expression levels of F4/80 (Fig. 6D and E). These results correlate with our observed increase in IL-10 production, a cytokine known to suppress the maturation of inflammatory monocytes during L. major infection (32). As precursors to macrophages and dendritic cells, these monocytes have been shown to play a crucial role in susceptibility to L. major (33, 34). Our results demonstrate that transgenic expression of CXCR3 in T cells of BC mice alters myeloid infiltration and maturation, which negatively affect the outcome of L. major infection in these mice.
Analysis of myeloid cell populations in BALB/c CXCR3Tg mice infected with L. major. (A) Flow cytometric analysis of neutrophil and monocyte populations in draining lymph nodes of L. major-infected BL/6 CXCR3+/+ and BL/6 CXCR3Tg mice. Plots are representative data from experiments with 3 mice per group with similar results. (B and C) Percentages of neutrophils (B) and monocytes (C) in draining lymph nodes of L. major-infected BC CXCR3+/+ and BC CXCR3Tg mice. Data represent means ± standard errors of the means of results from experiments with three individual mice per group. (D) Contour plots showing percentages of F4/80+ macrophages in lymph nodes of BC CXCR3+/+ and BC CXCR3Tg mice infected with L. major. Cells are gated on monocyte populations shown in panel A. Plots are representative data from experiments with 3 mice per group with similar results. (E) Percentages of total monocytes which are F4/80+ in lymph nodes of BC CXCR3+/+ and BC CXCR3Tg mice infected with L. major. Data represent means ± standard errors of the means of results from experiments with three individual mice per group. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (Student's unpaired t test).
DISCUSSION
This study clearly reveals that transgenic expression of CXCR3 in T cells exacerbates the course of L. major infection in BC mice. These results were unexpected as previous studies using a CXCR3 knockout model showed that endogenous CXCR3 expression is a major contributing factor to resistance against L. major (6). Although studies using the CXCR3-deficient model were performed in BL/6 mice, it is noteworthy that transgenic CXCR3 expression on T cells of this mouse strain does not increase protection against L. major infection. Interestingly, unlike BC mice, BL/6 CXCR3Tg mice are not more susceptible than BL/6 CXCR3+/+ littermates. The differences in disease outcomes between BL/6 CXCR3Tg and BC CXCR3Tg mice relative to their WT littermates in the present study indicate that the role of CXCR3 in our transgenic model varies within mouse strains. The effects of mouse strain differences in resistance to CL caused by L. major are well established (8, 35). While BL/6 mice develop a protective Th1 response and are naturally resistant to CL caused by L. major, BC mice are genetically susceptible and mount a Th2 response to the disease (8, 36). Induction of CXCR3 expression in vitro and in vivo during L. major infection has also been shown to be variable between these two stains: BL/6 mice upregulate CXCR3 much more efficiently than BC mice (7). It is evident that regulated CXCR3 expression in distinct subsets of activated T cells coupled with the predominant host immune response generated against L. major infection critically affects the outcome of murine CL.
BC mice are known for their inability to mount an effective Th1 immune response necessary for parasite eradication (8). Unlike BL/6 mice, their immune response is dominated by the generation of T helper cells which are deficient in IL-12Rβ2 expression and are unresponsive to IL-12-mediated IFN-γ production (36–38). Subsequent studies have also revealed a deficiency in the upregulation of CXCR3 expression on activated T cells in these mice (7). Although this deficiency is associated with susceptibility to L. major, evidence suggests that this is not directly responsible for the loss of resistance to the parasite but is simply an effect of the genetic inability of BC mouse T cells to respond to IL-12 stimulation after L. major infection (39). As such, contrary to our previous hypothesis, transgenic expression of CXCR3 in BC mouse T cells did not reduce susceptibility to L. major infection. Indeed, the disease was exacerbated in BC CXCR3Tg mice. Our analysis of infiltrating immune cells in infected BC mice suggests that Th1 polarization was not increased by transgenic CXCR3 expression. However, based on the frequency of Th2 cells and the amounts of IL-4 production in draining lymph nodes compared to levels in WT littermates, transgenic CXCR3 expression in activated Th2 cells appeared to have enhanced their recruitment to infected areas of the host.
In-depth analysis of cellular immune responses shows that transgenic expression of CXCR3 in T cells of BC mice significantly affects the recruitment and maturation of myeloid subsets that are involved in immunity against Leishmania. The early stages of L. major infection are characterized by significant accumulation of neutrophils, which is usually sustained in BC mice throughout the course of infection (40, 41). Leishmania parasites are able to evade the leishmanicidal activity of neutrophils, exploiting them as “Trojan horses” which mediate the silent entry of the parasite into mononuclear phagocytes (41–43). While the role of neutrophils in immunity to Leishmania remains controversial, numerous studies implicate early neutrophil recruitment as a major contributor to parasite growth and replication in the host (44). In vivo depletion of neutrophils in BC mice has been shown to significantly reduce parasite loads (45). Other studies show that large neutrophil accumulation during L. major infection of BC mice contributes to the early development of Th2 immune responses, and transient neutrophil depletion hinders Th2 response development, resulting in a resistance phenotype (31). The results of our study showed that transgenic expression of CXCR3 in T cells of BC mice resulted in increased neutrophil accumulation in draining lymph nodes after L. major infection. This increased neutrophil accumulation evidently contributed to an enhanced Th2 immune response and subsequent higher parasitic burdens in BC CXCR3Tg mice than in the BC CXCR3+/+ littermates.
During the early stages of L. major infection, monocytes are recruited to infection sites, where they engulf parasitized and apoptotic neutrophils. Monocytes are crucial to immunity against L. major as precursors to macrophages and inflammatory dendritic cells (33). As primary target host cells, they also serve as reservoirs of Leishmania parasites. Their ability to successfully eradicate intracellular L. major parasites depends on their degree of maturation and their activation state (34, 40, 46). Our study showed that transgenic expression of CXCR3 in T cells altered the recruitment of inflammatory monocytes during L. major infection of BC mice. Infected BC CXCR3Tg mice showed greater monocyte infiltration than the BC CXCR3+/+ littermates. The majority of infiltrating monocytes in infected CXCR3Tg mice displayed an immature phenotype, lacking expression of F4/80. Previous studies on experimental CL have shown that inflammatory monocytes lacking F4/80 expression are much less leishmanicidal than F4/80+ mature macrophages (46). BC mice are characteristically known to produce fewer F4/80+ mature macrophages than BL/6 mice, thereby facilitating parasite spread (46). The comparably reduced frequency of mature macrophages in BC CXCR3Tg mice is undoubtedly a contributing factor to the increased susceptibility to L. major. The immune-modulatory cytokine IL-10 is known to inhibit the maturation of inflammatory monocytes (32). We observed enhanced IL-10 production by L. major antigen-restimulated lymph node cells of infected BC CXCR3Tg mice, which could explain the increased frequency of immature monocytes in these mice. This unexpected effect of transgenic T cell expression of CXCR3 on monocyte maturation during L. major infection expands our current understanding of the role of CXCR3 in macrophage function (47–50).
In conclusion, we demonstrate the successful generation of a novel transgenic CXCR3 mouse model that will enable clarification of the role of CXCR3 in infectious, autoimmune, and neoplastic disease. Our results show that transgenic expression of CXCR3 on T cells exacerbates CL caused by L. major in BC mice by amplifying Th2 host immune responses, increasing neutrophil and inflammatory monocyte infiltration to infected sites, and inhibiting monocyte maturation.
ACKNOWLEDGMENTS
This work was supported by National Institutes of Health grants R03AI090231, RC4AI092624, R34AI100789, R21AT004160, and R03CA164399 awarded to A.R.S and by National Institute of Dental and Craniofacial Research Training Grant T32DE014320 awarded to S.O.
We do not have a commercial or other association that might pose a conflict of interest.
FOOTNOTES
- Received 22 August 2014.
- Returned for modification 10 September 2014.
- Accepted 3 October 2014.
- Accepted manuscript posted online 13 October 2014.
- Copyright © 2015, American Society for Microbiology. All Rights Reserved.
