Aeromonas salmonicida Growth in Response to Atlantic Salmon Mucins Differs between Epithelial Sites, Is Governed by Sialylated and N-Acetylhexosamine-Containing O-Glycans, and Is Affected by Ca²⁺

Fish and sampling procedures.Atlantic salmon parr (Långhult lax, Långhult, Sweden; the same fish as used in our previously published work [21, 22]) were transported to the Department of Biology and Environmental Sciences and kept in 500-liter tanks. The fish were held in recirculating 10°C FW, supplemented with 10% SW (yielding a salinity of 2 to 3‰), at a flow rate of 8.5 liters/min. The fish were exposed to a simulated natural photoperiod and were hand-fed ad libitum once daily with a commercial dry pellet (Nutra Olympic/3-mm diameter plate; Skretting Averøy, Ltd., Stavanger, Norway).

Five fish (31.06 ± 0.49 cm body length and 280.70 ± 12.78 g body weight; means ± standard errors of the means [SEM]) were randomly netted, anesthetized in metomidate (12.5 mg/liter), and killed with a sharp blow to the head. Mucus from the skin was sampled by gentle scraping of the entire skin surface using microscopy glass slides. The fish were then opened longitudinally and the intestine, from the last pyloric ceca to the anus, was quickly dissected. The intestine was cut open along the mesenteric border, the proximal region was separated from the distal at the ileorectal valve, and the mucus and mucosa were scraped off using microscopy slides. The pyloric ceca were dissected and placed in liquid nitrogen and pulverized using a mortar and a pestle. All samples were placed in 10 mM sodium dihydrogen phosphate containing 0.1 mM phenylmethylsulfonyl fluoride (PMSF) pH 6.5 (sampling buffer) to inhibit proteolytic cleavage.

Isolation and purification of mucins.The scrapings and pulverized tissues in sampling buffer were added to five sample volumes of extraction buffer (6 M guanidine hydrochoride [GuHCl], 5 mM EDTA, 10 mM sodium phosphate buffer [pH 6.5] and containing 0.1 M PMSF), homogenized with a Dounce homogenizer (four strokes with a loose pestle), and stirred slowly at 4°C overnight. The insoluble material was removed by centrifugation at 23,000 × g for 50 min at 4°C (Beckman JA-30 rotor), and the pellet was reextracted twice with 10 ml extraction buffer. The supernatants from these three extractions were pooled and contained the GuHCl-soluble mucins used in the subsequent assays. The samples were dialyzed twice against 10 volumes of extraction buffer and filled to 26 ml with extraction buffer. CsCl was added to the samples by gentle stirring, and the samples were transferred to Quick Seal ultracentrifuge tubes (Beckman Coulter). The tubes were filled with 10 mM NaH₂PO₄ to give a starting density of 1.35 g/ml, and samples were subjected to density gradient centrifugation at 40,000 × g for 90 h at 15°C. The fractions were collected from the bottom of the tubes with a fraction collector equipped with a drop counter. Density gradient fractions of purified mucin samples were analyzed for carbohydrates as periodate-oxidizable structures in a microtiter-based assay. Fractions were diluted 1:100, 1:500, and 1:1,000 in 4 M GuHCl were added to 96-well plates (PolySorp; Nunc A/S, Roskilde, Denmark) to coat them and incubated overnight at 4°C. The rest of the assay was carried out at 23 to 24°C. After washing three times with washing solution (5 mM Tris-HCl, 0.15 M NaCl, 0.05% Tween 20, 0.02% NaN₃; pH 7.75), the carbohydrates were oxidized by adding 25 mM sodium metaperiodate in 0.1 M sodium acetate buffer, pH 5.5, for 20 min. The plates were washed again and the wells were blocked with Delfia blocking solution (50 mM Tris-HCl, 0.15 M NaCl, 90 mM CaCl₂, 4 mM EDTA, 0.02% NaN₃, 0.1% bovine serum albumin [BSA]; pH 7.75) for 1 h. After further washing steps, the samples were incubated for 1 h with 2.5 mM biotin hydrazide in 0.1 M sodium acetate buffer, pH 5.5, followed by another washing step. Europium-labeled streptavidin was diluted 1:1,000 in Delfia assay buffer (50 mM Tris-HCl, 0.15 M NaCl, 20 mM diethylenetriaminepentaacetic acid, 0.01% Tween 20, 0.02% NaN₃, 1.5% BSA; pH 7.75 [PerkinElmer]) and was added to the wells. After 1 h of incubation, the plates were washed six times and then incubated with Delfia enhancement solution (0.05 M NaOH, 0.1 M phthalate, 0.1% Triton X-100, 50 mM tri-n-octylphosphineoxide, 15 mM 2-naphthoyltrifluoroacetone; PerkinElmer) for 5 min at 120 rpm on an orbital shaker. Fluorescence (λ_excitation = 340 nm; λ_emission = 615 nm) was measured using a Wallac 1420 Victor₂ plate reader with the europium label protocol (PerkinElmer, Waltham, MA, USA). Density measurements were performed using a Carlsberg pipette as a pycnometer; 300 μl of sample was aspirated into the pipette, weighed, and the density was calculated as grams per milliliter. The DNA concentration was calculated based on the light absorbance at 280 nm.

Preparation of mucin samples.Gradient fractions containing mucins were pooled to obtain one sample for each gradient (Fig. 1A). Mucin concentrations in pooled samples were determined based on their carbohydrate content: serial dilutions of the samples were compared with a standard curve prepared from a fusion protein, constructed from MUC1, 16TR, and IgG2a Fc. The standard curve started at a concentration of 20 mg/ml followed by seven 1:2 serial dilutions. The carbohydrates were detected as periodate-oxidizable structures in a microtiter-based assay described above. This method of concentration determination was chosen because all mucins do not come into solution after freeze-drying, and determining the concentration by freeze-drying therefore can generate large errors as well as selectively remove certain mucin species. Although this is not an exact measure of concentration, it can be used to ensure that the mucins are at the same concentration for comparative assays, and since bacterium-mucin interactions largely occur via the mucin glycans (15), setting the concentration based on the glycan content appears most appropriate.

Aeromonas salmonicida culture conditions.A. salmonicida strain VI-88/09/03175 (culture collection of Central Veterinary Laboratory, Oslo, Norway) was cultured in brain heart infusion broth (BHI) at 19°C, and stocks were stored in BHI-glycerol (1:1) at −80°C. Before the growth experiments, A. salmonicida was cultured overnight in BHI broth on a laboratory shaker at 120 rpm and washed three times with phosphate-buffered saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer; pH 7.4) at 3,000 × g for 5 min.

Growth assay.A. salmonicida cells, at a concentration equivalent to an optical density at 600 nm (OD₆₀₀) of 0.1, were cultured in glucose-containing (DM+) and glucose-lacking (DM-). These two media contained 0.43 mM Ca(NO₃)₂ and the pH was 7.4. For the analyses on the effects of pH and Ca²⁺ on the growth of A. salmonicida, the DM- pH was set to 7.2 or 7.8 via HCl. Two Ca²⁺ concentrations, corresponding to soft FW (0.1 mM) and SW (10 mM), were used. The former had an osmolality of 98 mOsm/liter and for the latter it was 127 mOsm/liter. CaCl₂ was used to manipulate the Ca²⁺ concentration; to certify that the accompanying change in Cl⁻ did not have a major impact on the results, we carried out parallel growth assays with equimolar Ca(NO₃)₂ or CaCl₂ solutions and obtained similar results (data not shown). Purified mucin samples in 4 M GuHCl were dialyzed against PBS eight times and diluted in sterile PBS to a concentration of 100 μg/ml. The glycans were used at the same concentration. The GuHCl-containing isolation buffer was dialyzed and diluted in parallel and used as a reference of normal growth (dialysis control [DC]). PBS was used as a reference for growth in the presence of monosaccharides and oligosaccharides. Monosaccharides were purchased from Sigma-Aldrich. GD1a-oligosaccharide, GlcNAcβ1,3Gal, and GalNacβ1,3Gal were purchased from Elicityl, France. Core 1 glycan (Galβ1,3GalNAc) was purchased from Dextra Laboratories, UK. Bacteria were cultured in 96-well Nunc-Delta surface flat-bottom plates (Nunc A/S, Roskilde, Denmark) in 4 to 8 replicates at 23°C and 120 rpm in the presence of alamarBlue (Invitrogen) to monitor reduction of the dye.

Culture media.(i) DM- medium contained 0.1 g/liter Ca(NO₃)₂·4H₂O, 0.4 g/liter KCl, 0.1 g/liter MgSO₄·7H₂O, 6 g/liter NaCl, 0.8 g/liter Na₂HPO₄, 2 g/liter NaHCO₃, 2 mg/liter FeSO₄, 5 g/liter BSA, 50 mg/liter adenine, 3 mg/liter lipoic acid. For amino acids, DM- medium contained 44.5 mg/liter alanine, 632 mg/liter arginine, 75 mg/liter asparagine, 66.5 mg/liter aspartic acid, 120 mg/liter cysteine, 73.5 mg/liter glutamic acid, 300 mg/liter glutamine, 37.5 mg/liter glycine, 110 mg/liter histidine, 262.5 mg/liter isoleucine, 262 mg/liter leucine, 362.5 mg/liter lysine, 75.5 mg/liter methionine, 165 mg/liter phenylalanine, 57.5 mg/liter proline, 52.5 mg/liter serine, 238 mg/liter threonine, 51 mg/liter tryptophan, 180 mg/liter tyrosine, 234 mg/liter valine. The vitamin content of DM- medium was as follows: 0.2 mg/liter d-biotin, 3 mg/liter choline chloride, 1 mg/liter folic acid, 35 mg/liter myo-inositol, 1 mg/liter niacinamide, 1 mg/liter p-aminobenzoic acid, 1.25 mg/liter d-pantothenic acid, 1 mg/liter pyridoxine hydrochloride, 0.2 mg/liter riboflavin, 1 mg/liter thiamine hydrochloride, 5 μg/liter vitamin B₁₂ (cyanocobalamin). (ii) The DM+ medium was the same as DM- medium, with the addition of 2 g/liter glucose.

Aeromonas salmonicida binding to mucins.The mucin binding assays were carried out as described previously (22). Briefly, mucins were diluted in 4 M GuHCl–PBS and added to 96-well Polysorp plates overnight at 4°C. The plates were washed three times with washing buffer (PBS containing 0.05% Tween 20) and blocked for 1 h with blocking buffer (0.5% BSA in washing buffer). After discarding the blocking buffer, bacteria cultured in the log phase of growth were washed and diluted in blocking buffer to an OD₆₀₀ of 0.1 and then further diluted 1:10 in blocking buffer. The bacterial suspension was added to the plates, which then were incubated at 120 rpm for 2 h. The plates were washed three times and then incubated for 1 h at room temperature with blocking buffer containing anti-A. salmonicida IgG monoclonal antibody (clone 3B11/G5; Austral Biological, San Ramon, CA) diluted 1:5,000. After washing, horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) diluted 1:10,000 in blocking buffer was added. After further washing steps, 100 μl tetramethylbenzidine (TMB) substrate (Sigma-Aldrich Co.) was added, and the plates were incubated for 20 min. The reaction was stopped with 100 μl of 0.5 M H₂SO₄, and the plates were analyzed in a microplate reader at 450 nm after color stabilization. The binding was analyzed at four mucin concentrations (2-fold dilution steps) with results that were similar when the binding signal was expressed per unit of carbohydrate signal for at least three of the concentrations (i.e., the assay was performed within a linear range), including a glycan value of 20,000 europium counts (approximately corresponding to a 4-μg/ml mucin concentration). For each analysis, parallel microtiter plates were coated for glycan detection analysis to ensure that small differences in binding were not due to mucin coating differences. The reported binding values were normalized for a glycan value of 20,000 europium counts.

To study the effect of Ca²⁺ on A. salmonicida binding, a modified binding assay was used with the following differences from the assay described above. A. salmonicida was cultured overnight in DM- containing 0.43 mM Ca(NO₃)₂ (control) or 10 mM Ca(NO₃)₂. The blocking buffer used in each step of the assay was set to pH 7.8, had no calcium in the control wells, and included 10 mM Ca(NO₃)₂ for the rest of the wells.

Analysis of mucin glycan structures and correlation with bacterial growth.A data set from a previously published study on the O-glycan structures from salmon mucins, based on analysis using liquid chromatography-mass spectrometry and tandem mass spectrometry (MS/MS) data (21), was used to calculate the data shown in Fig. 2. Weighted average glycan chain lengths of carbohydrate structures on each mucin sample were calculated using the relative abundance (percentage) of each glycan structure. The Neu5Ac content used for the correlation analysis with bacterial growth was calculated using the relative quantity of each identified O-glycan structure and the number of Neu5Ac residues on those structures. The ratio of terminal residues (Fig. 2B) on Atlantic salmon mucins was calculated using each terminal residue on all structures (e.g., Neu5Ac, Neu5Ac, and GlcNAc on a branched structure with three terminal residues) and the relative abundance of those structures.

Genome alignment search.The β-N-acetylhexosaminidase gene is part of a cluster of 10 genes in strain A449, and these are possibly part of the same operon (GenBank identifiers of the genes in A449 are ABO91093.1, ABO91094.1, ABO91095.1, ABO91096.1, ABO91097.1, ABO91098.1, ABO91099.1, ABO91100.1, ABO91101.1, ABO91102.1). Each of the 10 proteins in the cluster were used as queries in a Basic Local Alignment Search Tool (BLAST) search against all available A. salmonicida genomes (A449, 01-B526, CBA100, 2004-05MF26, JF3224, Y567, JF4097, Y47, Y577, RS534, JF3791, J223, J231, ATCC 33658, J227, 170-68, 01-B522, JF2267, 2009-157 K5, 2010-47 K18, JF2506, JF2507, JF3517, and A. salmonicida subsp. achromogenes AS03, A. salmonicida subsp. pectinolytica, and A. salmonicida subsp. masoucida NBRC). The output from these BLAST searches was used to identify genomic locations of the proteins in all strains. The A. salmonicida subsp. salmonicida A449 genome was also searched for homologies for the Aeromonas hydrophila sialidase.

Sialidase activity assay.Sialidase activity of A. salmonicida was analyzed with the modified method of Crost et al. (19). Briefly, 20 μl of fresh A. salmonicida liquid culture was added to a reaction mixture consisting of 500 μM 4MU-Neu5Ac (Sigma-Aldrich Co.) as a substrate in PBS, pH 7.4. The enzymatic reactions were carried out at 23°C for up to 10 h in a plate reader (BMG Labtech, Ortenberg, Germany). The fluorescence of the liberated 4MU was quantified at λ_excitation of 340 nm and λ_emission of 420 nm at 10-min intervals in a white opaque 96-well plate (Falcon). Sialidase A (5 U/ml) diluted 1,000-fold in the final reaction mixture (ProZyme, Hayward, Canada) was used as a positive control, and the negative control was DM-. The assay was carried out at final CaCl₂ concentrations of 0.1, 0.43, and 10 mM.

Desialylation and β-N-acetylhexosaminidase treatment of mucins.Sialidase A (ProZyme) or β-N-acetylhexosaminidase (ProZyme) treatment was performed on mucins pooled from five salmon. Samples were dialyzed against sterile 50 mM Na₃PO₄ buffer four times with a cellulose dialysis membrane with a molecular mass cutoff value of 14 kDa (Sigma-Aldrich Co.). PBS containing 4 M GuHCl was subjected to the same procedure, as the dialysis control (DC). Five microliters of sialidase A or β-N-acetylhexosaminidase enzyme was added to 500 μl of dialyzed mucin sample or DC. Sialidase A or β-N-acetylhexosaminidase enzyme was replaced with dialysis buffer for the mock-treated controls. Samples were incubated at 37°C, 70 rpm overnight for 13 h. After the enzyme treatment, samples were dialyzed against sterile PBS four times in a dialysis membrane with a molecular mass cutoff value of 100 kDa for sialidase A and 300 kDa for β-N-acetylhexosaminidase (Sigma-Aldrich Co.; sialidase A is 88 kDa, and β-N-acetylhexosaminidase is ca. 110 kDa). The dialyzed samples were stored at −80°C.

MS to confirm enzymatic removal of glycan moieties.β-Hexosaminidase, α-sialidase digestedm and mock-treated skin and distal intestinal mucins were dot blotted to a polyvinylidene difluoride membrane (Immobilon P membrane; Millipore, Billerica, MA) and visualized with alcian blue stain (Sigma-Aldrich). Stained spots were cut and subjected to reductive β-elimination with 0.5 M NaBH₄ and 50 mM NaOH for 16 h at 50°C to release the glycans. The reduction reaction was quenched by using glacial acetic acid, and the mixture was desalted as the nonretained fraction on strong cation exchange resin packed as a microcolumn on top of hydrophobic C₁₈ material. The solid-phase extraction removed cations and any remaining protein or peptide components. Released O-glycans were analyzed by liquid-chromatography (LC)-MS/MS using a 10-cm by 250-μm (inner diameter) column (in-house) containing 5-μm porous graphitized carbon particles (Thermo Scientific, Waltham, MA, USA) connected to an LTQ mass spectrometer (Thermo Scientific). O-Glycans were eluted using a linear gradient from 0 to 80% acetonitrile in 10 mM ammonium bicarbonate over 40 min at a flow rate of 250 nl/min. Electrospray ionization-MS was performed in negative ion polarity with an electrospray voltage of 3.5 kV, capillary voltage of −33.0 V, and capillary temperature of 300°C. The data were viewed and manually analyzed using Xcalibur software (version 2.2; Thermo Scientific). Due to the dense and complex glycosylation of mucins, complete enzymatic elimination of carbohydrate moieties cannot be expected. MS analysis confirmed success of the sialidase treatment, showing an overall ca. 60% reduction of sialylation, as exemplified by three sialylated structures (m/z 878, 1,081, and 1,372) and a consequent increase in relative abundance of selected nonsialylated structures (m/z 587 and isomers 790a and -b). The structures to which the m/z values correspond are defined in Table 1. After hexosaminidase treatment, we confirmed partial removal (15 to 45%, depending on individual structures) of HexNAc from distal intestinal mucins, as exemplified by structures with m/z 587, 790, and 1,081 and a subsequent increase in the corresponding structures with m/z 384 and 878, lacking the terminal HexNAc. In skin mucins, we found more than a 50% decrease in the abundance of m/z 587 and 790 and an increase in the abundance of the subsequent cleaved structure, m/z 384.

RNA extraction, cDNA synthesis, and real-time PCR.After 7 h of culturing A. salmonicida in DM- medium with 0.43 mM CaCl in the absence (control) or presence of 100 μg/ml glycan or mucin, 200 μl of RNAprotect bacteria reagent (Qiagen GmbH, Hilden, Germany) was added to each well, and 12 wells per sample were pooled. RNA extraction was continued with Qiagen's RNeasy kit, including the DNase treatment step with Qiagen's RNase-free DNase set.

The purity of RNA samples was verified based on the OD₂₆₀/OD₂₈₀ ratio. cDNA was synthesized using the Quantitect reverse transcription kit (Qiagen) according to the manufacturer's instructions. In “−RT” reactions, the reverse transcriptase enzyme was replaced with nuclease-free H₂O, thereby enabling the detection of contaminating DNA only. We confirmed the absence of contaminating DNA in each sample. Real-time PCR assays were run in 96-well plates (Bio-Rad), in a total volume of 20 μl containing 10 μl Power SYBR green PCR master mix (Thermo Fisher Scientific), 9 μl molecular biology-grade water, and 1 μl of template diluted 10-fold. The primer pair for the A. salmonicida subsp. salmonicida A449 β-N-acetylhexosaminidase (ASA_RS14095) gene was designed using the Primer 3 software (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) (forward, TGACCGTACCGACTACACCT; reverse, AAGTGGAAGGTCTTGAGCGG). For the 16S reference gene, we used a previously validated primer pair described previously by Menanteau-Ledouble et al. (forward, ATATTGCACAATGGGGGAAA; reverse, GTTAGCCGGTGCTTCTTCTG) (52). The primer pairs were used at a final concentration of 250 nM. Amplification efficiencies of the selected primers were tested and met general requirements of RT-PCR analysis. Amplification was performed using a CFX96 real-time PCR detection system (Bio-Rad Laboratories) with default settings for the amplification protocol and included a dissociation step in the end of the program for melting temperature (T_m) analysis to confirm amplification specificity. The purity of the template was controlled with the use of nontemplate control wells. The results in Fig. 3D are expressed as the fold change of the β-N-acetylhexosaminidase/16S gene expression ratio, compared to that for the nonglycan/mucin control.

Statistical analyses.Statistical analyses were performed using the Prism 5.0 software package (GraphPad Software Inc.). Student t tests and one-way analysis of variance (ANOVA) followed by Dunnett′s post hoc test were used to compare groups and treatments, as indicated in the figure legends. The level of significance was set at P ≤ 0.05.