ABSTRACT
Yersinia pseudotuberculosis is a Gram-negative enteropathogen and causes gastrointestinal infections. It disseminates from gut to mesenteric lymph nodes (MLNs), spleen, and liver of infected humans and animals. Although the molecular mechanisms for dissemination and infection are unclear, many Gram-negative enteropathogens presumably invade the small intestine via Peyer’s patches to initiate dissemination. In this study, we demonstrate that Y. pseudotuberculosis utilizes its lipopolysaccharide (LPS) core to interact with CD209 receptors, leading to invasion of human dendritic cells (DCs) and murine macrophages. These Y. pseudotuberculosis-CD209 interactions result in bacterial dissemination to MLNs, spleens, and livers of both wild-type and Peyer’s patch-deficient mice. The blocking of the Y. pseudotuberculosis-CD209 interactions by expression of O-antigen and with oligosaccharides reduces infectivity. Based on the well-documented studies in which HIV-CD209 interaction leads to viral dissemination, we therefore propose an infection route for Y. pseudotuberculosis where this pathogen, after penetrating the intestinal mucosal membrane, hijacks the Y. pseudotuberculosis-CD209 interaction antigen-presenting cells to reach their target destinations, MLNs, spleens, and livers.
INTRODUCTION
Yersinia pseudotuberculosis is a Gram-negative enteropathogen that usually causes food-borne gastrointestinal infections in humans and animals. It belongs to the genus Yersinia, which includes 17 different species (1), of which Y. enterocolitica and Y. pestis cause gastroenteritis and plague, respectively (2–5), and Y. ruckeri causes enteric red mouth disease of salmonid fish (6). Y. pestis has evolved from Y. pseudotuberculosis within the last 10,000 to 20,000 years (7–9). The ability to disseminate to and infect the regional lymph nodes is a characteristic hallmark of Y. pseudotuberculosis infection (10). Y. pseudotuberculosis disseminates to mesenteric lymph nodes (MLNs) directly from a replicating bacterial pool in the intestinal lumen (11). However, the molecular mechanisms and host cells involved in dissemination of Y. pseudotuberculosis to MLNs remain to be determined. On the other hand, the mechanisms used by Salmonella for dissemination have been studied, as outlined in an excellent review article (12). Salmonella spp. appear to utilize antigen-presenting cells (APCs), such as dendritic cells (DCs), as a carrier to reach the MLNs, after either penetrating the mucosal membranes or passing through the Peyer’s patches (12, 13). While the molecular mechanisms of the DC-associated dissemination of Salmonella are still unknown, it was shown that the core region of the lipopolysaccharide interacts with the human DC-SIGN (hDC-SIGN; CD209) receptor of DCs (14). DC-SIGN is also a receptor of HIV that hijacks the DCs to promote viral dissemination to target cells, such as CD4 lymphocytes in lymph nodes (15, 16).
Over 70% of the surface of Gram-negative bacteria is occupied by lipopolysaccharide (LPS), which generally consists of three structural regions: (i) lipid A, (ii) the oligosaccharide core, and (iii) the O-polysaccharide (OPS) or O-antigen (O-ag) (Fig. 1). LPS produced by smooth bacteria is known as smooth LPS, while LPS lacking O-ag is known as rough LPS or lipooligosaccharide (LOS). O-ag is a virulence factor of Y. pseudotuberculosis; however, its production is suppressed in bacteria grown at 37°C (17–19), suggesting also that the LPS core would be exposed in bacteria growing in vivo (Fig. 1). The apparent question, then, is why Y. pseudotuberculosis would subdue the production of O-ag, its virulence factor, during infection.
Structures of inner core and outer core regions of the LPS or LOS of E. coli K-12, S. enterica serovar Typhimurium, Y. pestis, and Y. pseudotuberculosis and the genes involved in their biosynthesis. Genes involved in the biosynthesis of core LPS are shown at their approximate site of action (solid line). The sites that are variably substituted or still under investigation are indicated by dashed lines. Abbreviations: GlcNAc, N-acetylglucosamine; Glc, glucose; Hep, l-glycero-d-manno-heptose; Gal, galactose; P, phosphate; PPEtn, phosphoethanolamine; KDO, 2-keto-3-deoxyoctonate. It should be noted that E. coli K-12 and Y. pestis naturally do not possess an O-antigen.
Both Y. pseudotuberculosis and Salmonella are enteropathogens; therefore, we asked if the LPS core of Y. pseudotuberculosis also interacts with DC-SIGN and, if so, whether this interaction would lead to the dissemination of Y. pseudotuberculosis to MLNs. Y. pseudotuberculosis, after overcoming the first line of host defense, the mucosal membrane of the small intestine, with the help of the virulence factors invasin (20, 21) and Ail (22–24), encounters in the intestinal tissue secondary host defense systems such as DCs and macrophages. Here, we present evidence that rough LPS-producing Y. pseudotuberculosis exploits APCs via LOS (rough LPS)-CD209 interaction as a means to disseminate to lymph nodes, spleen, and liver to initiate host infection.
RESULTS
Peyer’s patches may not play a major role in dissemination of Y. pseudotuberculosis.One of the dissemination mechanisms used by Salmonella involves passage through Peyer’s patches (12, 13). To examine whether the dissemination of Y. pseudotuberculosis involves the Peyer’s patches, we used a Peyer’s patch-deficient mouse model carrying a deletion of the lymphotoxin-LTβR-1 gene (25). Figure 2 shows that dissemination of the Y. pseudotuberculosis strain YPIII bacteria to MLNs, livers, and spleens was not reduced in the Peyer’s patch-deficient mice, suggesting that Peyer’s patches do not play a major role in dissemination of Y. pseudotuberculosis. It should be noted that MLNs are also underdeveloped in the LTβR-1 knockout (KO) mice (25).
Dissemination of Y. pseudotuberculosis in Peyer’s patch-deficient mice. Wild-type and lymphotoxin-LTβR-1-deleted mice (25) were orally infected with 108 CFU of Y. pseudotuberculosis YPIII (37). The dissemination rate (bacterial load) in the spleens, livers, and MLNs was quantified at 72 h after infection. *, P < 0.05.
hDC-SIGN and murine SIGNR1 (mSIGNR1) are receptors for phagocytosis of Y. pseudotuberculosis.If Peyer’s patches were not the dissemination route of Y. pseudotuberculosis, the pathogen, after passage through the mucosal membrane, encounters the secondary host defense system, including DCs and macrophages. Given that Y. pseudotuberculosis produces rough LPS (LOS) when grown at 37°C (17–19), we examined the interactions of APCs with Y. pseudotuberculosis bacteria grown at 37°C and at 26°C.
(i) Y. pseudotuberculosis bacteria cultured at 37°C but not at 26°C invade human dendritic cells and mouse macrophages. We first examined the ability of Y. pseudotuberculosis strain Y1 bacteria grown at 37°C or 26°C to invade human DCs and mouse macrophages. The Escherichia coli K-12 strain CS180 (with rough LPS) and CS1861 (CS180 derivative with smooth LPS) bacteria were used as controls (14, 26). The gentamicin protection assay (Fig. 3A and C) and flow cytometry (Fig. 3B and D) experiments showed that Y1 bacteria cultured at 37°C invaded human DCs and macrophages much more effectively than Y1 bacteria cultured at 26°C. The results suggest that lack of O-ag on Y1 bacteria grown at 37°C contributes to the invasion of human DCs and mouse macrophages.
Y. pseudotuberculosis cultured at 37°C but not 26°C invades human DCs and murine macrophages. Gentamicin protection- and flow cytometry-based assays were used to determine the DC invasion rates of Y. pseudotuberculosis Y1. E. coli K-12 strains (CS180 and CS1861) were utilized as controls. (A and C) Data from the gentamicin protection assay. (B and D) Data from flow cytometry. DCs and macrophages incubated with labeled and unlabeled bacteria are indicated by open and filled curves, respectively. Y. pseudotuberculosis organisms cultured at 37°C and 26°C are referred to as 37-Y1 and 26-Y1, respectively. ***, P < 0.001.
(ii) Y. pseudotuberculosis Y1 cultured at 37°C but not at 26°C promotes hDC-SIGN- and mSIGNR1-mediated invasion of host cells. hDC-SIGN is a receptor for E. coli and other Gram-negative bacteria with rough-type LPS (14, 26). Furthermore, we have unpublished evidence suggesting that the Y. pestis LOS uses the mouse SIGNR1, not the mouse DC-SIGN, SIGNR3, or langerin (mCD207), as a receptor. To investigate whether human DC-SIGN and mouse SIGNR1 were responsible for the interaction of human DCs and mouse macrophages, stably transfected cell lines expressing human DC-SIGN (HeLa-hDC-SIGN) and murine SIGNR1 (CHO-mSIGNR1) were tested for their ability to phagocytose Y1 bacteria grown at 37°C and 26°C (37-Y1 and 26-Y1, respectively). Again, E. coli CS180 and CS1861 bacteria were used as controls.
Two observations were made from these experiments (Fig. 4). First, 26-Y1 bacteria invaded all cells (HeLa, HeLa-hDC-SIGN, CHO, and CHO-mSIGN-R1) at similar rates, indicating that neither hDC-SIGN nor mSIGNR1 was necessary for the invasion. In Y. pseudotuberculosis, three invasion factors, invasin, YadA, and Ail, participate in the host-pathogen interactions (21, 23, 27). Very likely, the very effective hDC-SIGN/mSIGNR1-independent interaction with HeLa and CHO cells (Fig. 4A and B) is mediated by interaction between invasin and its receptor, β-integrin, which is expressed on most epithelial cells (20, 21). Second, 37-Y1 bacteria invaded HeLa-hDC-SIGN (Fig. 4A) and CHO-mSIGNR1 (Fig. 4B) cells more effectively than HeLa-Neo and CHO-Neo cells. It should be noted that the invasion rate of 37-Y1 bacteria into HeLa cells was lower than that of 26-Y1 bacteria, as invasin expression is repressed at 37°C (28).
HeLa-hDC-SIGN and CHO-mSIGNR1 transfectants phagocytose Y. pseudotuberculosis grown at 37°C. The phagocytosis of two pairs of bacteria, E. coli K-12 (CS180 and CS1861) and Y. pseudotuberculosis Y1, cultured at 26°C and 37°C with HeLa/HeLa-hDC-SIGN (A) and CHO/CHO-mSIGNR1 (B), was performed by incubating cell lines for 2 h with indicated bacterial strains and by killing the extracellular bacteria with gentamicin as described in Materials and Methods. The number of phagocytosed bacteria was determined by counting CFU recovered following gentamicin treatment. ***, P < 0.001.
Based on the evidence described above, we conclude that hDC-SIGN and mSIGNR1 function as receptors and contribute to the phagocytosis of 37-Y1 in cell lines.
The LPS core of Y. pseudotuberculosis serves as a ligand. The data described above revealed similar invasion patterns of HeLa-hDC-SIGN and CHO-mSIGNR1 cells for E. coli CS180 and 37-Y1. Since the LPS core of E. coli is a ligand for hDC-SIGN (26), we speculated that the interaction of 37-Y1 bacteria with hDC-SIGN and mSIGNR1 would also be due to the exposed LPS core.
To confirm this hypothesis, we tested the interaction of two isogenic pairs of Y. pseudotuberculosis strains, PB1 and PB1Δwb strains and PB1ΔailΔinv and PB1ΔwbΔailΔinv strains, with human DCs (Fig. 5A), mouse macrophages (Fig. 5B), HeLa or HeLa-hDC-SIGN cells, and CHO or CHO-mSIGN-R1 cells (Fig. 6A and B). It should be noted that the wild-type Y. pseudotuberculosis strain PB1 produces smooth LPS, and its PB1Δwb rough isogenic derivative produces LOS (29, 30). In addition, for this experiment, the virulent plasmid in PB1 and its isogenic derivatives was deleted.
Human DCs and mouse macrophages phagocytose the defined rough Y. pseudotuberculosis. The phagocytosis of Y. pseudotuberculosis by human DCs (A) and mouse macrophages (B) followed the same procedures as those described in the legend to Fig. 3. The two strains used were the smooth LPS-producing Y. pseudotuberculosis PB1 and its isogenic rough derivative, the PB1Δwb strain, lacking the O-ag. (A and B) Data from the gentamicin protection assay. (C) Data from flow cytometry. DCs and macrophages with labeled and unlabeled bacteria are indicated by open and filled curves, respectively. ***, P < 0.001.
Human DC-SIGN and mouse SIGNR1 transfectants phagocytose the rough Y. pseudotuberculosis. The invasion of HeLa-hDC-SIGN (A) and CHO-mSIGNR1 (B) with PB1/PB1Δwb and PB1ΔailΔinv/PB1ΔwbΔailΔinv strains followed the same procedures as described for Fig. 4. ***, P < 0.001.
As shown in Fig. 6, the rough PB1Δwb bacteria with or without an inv- and ail-deleting background, even when grown at 26°C, promoted the very typical core-mediated interaction with hDC-SIGN (26) and mSIGNR1, whereas the smooth PB1 did not. Taken together, the ability of rough Y. pseudotuberculosis to interact with human DCs, mouse macrophages, HeLa-hDC-SIGN, and CHO-mSIGN-R1 cells is most likely due to interactions between the exposed LPS core and hDC-SIGN and mSIGN-R1.
The interactions between LPS core and hDC-SIGN/mSIGN-R1 were inhibited by additions of anti-hDC-SIGN/mSIGN-R1, mannan, and LPS core oligosaccharides.To confirm that LPS core of Y. pseudotuberculosis is involved in the interaction, we examined whether the interactions of HeLa-hDC-SIGN and CHO-mSIGN-R1 transfectants with rough Y. pseudotuberculosis could be inhibited by anti-hDC-SIGN antibody, anti-mSIGN-R1 antibody, mannan, which specifically binds mannose-related receptors, and LPS core. Anti-CD66 antibody was used as a control antibody. As shown in Fig. 7A and B, the invasion of HeLa-hDC-SIGN and CHO-mSIGNR1 by the PB1ΔwbΔailΔinv strain was blocked by addition of all three inhibitors.
Phagocytosis of Y. pseudotuberculosis PB1ΔwbΔailΔinv strain by HeLa-DC-SIGN and CHO-mSIGN-R1 was blocked by anti-hDC-SIGN antibody, anti-mSIGN-R1 antibody, mannan, and LPS core. (A) Pretreated HeLa-NEO and HeLa-hDC-SIGN cells with anti-hDC-SIGN antibody, mannan, and LPS core were incubated for 2.5 h with the Y. pseudotuberculosis PB1ΔwbΔailΔinv strain. Bacterial phagocytosis was measured as described in Materials and Methods. (B) Pretreatment of cells with anti-mSIGN-R1 antibody, mannan, and LPS core blocked phagocytosis of the Y. pseudotuberculosis PB1ΔwbΔailΔinv strain to CHO-mSIGN-R1. P < 0.001.
Although the anti-hDC-SIGN, mannan, and LPS core failed to show any significant impact on the phagocytosis of Y. pseudotuberculosis of the PB1ΔwbΔailΔinv strain, when used separately (Fig. 8), this hDC-rough Y. pseudotuberculosis interaction showed a reduction when the triple reagents were applied. In our previous studies, we found that anti-DC-SIGN antibody alone cannot effectively inhibit the LPS core-mediated phagocytosis of E. coli, Neisseria gonorrhoeae, and Y. pestis by DCs (14, 26, 31–33). We speculated that other receptors also are involved in the phagocytosis of the core-exposed Gram-negative bacteria. Details are addressed in Discussion.
Reduction of phagocytosis of Y. pseudotuberculosis PB1ΔwbΔailΔinv strain by DCs in the presence of anti-DC-SIGN, mannan, and LPS core together. Besides the addition of anti-hDC-SIGN, mannan, and LPS core, the procedures followed were the same as those described for DCs in the legend to Fig. 5A. P < 0.001 by two-way ANOVA comparing the interaction of DCs with Y. pseudotuberculosis PB1ΔwbΔailΔinv strain in the presence of anti-hDC-SIGN, mannan, and LPS core to the interaction in the absence of antibody.
The LPS core-mediated phagocytosis of Y. pseudotuberculosis by macrophages occurs in vivo.While it is clear that the LPS core participates in the in vitro interaction of Y. pseudotuberculosis with APCs, it remained to be elucidated whether this interaction also occurs in vivo. To this end, we injected bacterial suspensions directly into the intraperitoneal cavity of live mice. This approach is analogous to our previous study showing that the interaction of mouse CD205 (DEC-205) receptor on alveolar macrophages with the Y. pestis plasminogen activator (Pla) occurs in vivo (34). The intraperitoneal exudate was collected from the mice 1.5 h after the infection and placed in gentamicin medium to kill the extracellular bacteria. Figure 9 shows that a higher percentage of the PB1Δwb bacteria than of the wild-type PB1 strains were intracellular and, thus, protected from gentamicin killing.
Interaction of the LPS core with macrophages occurs in vivo. Bacterial suspensions of PB1Δwb and PB1 strains, cultured at 26°C, were inoculated into the intraperitoneal cavity of live mice. After incubation for 1.5 h, collected macrophages were examined for the rate of internalized bacteria. ***, P < 0.001.
The data suggest that the LPS core interaction with mSIGNR1 had mediated phagocytosis of Y. pseudotuberculosis by macrophages in vivo.
The exposure of the LPS core enhances the dissemination of Y. pseudotuberculosis to MLNs, spleen, and liver.We have demonstrated here that Y. pseudotuberculosis, when grown at 37°C, uses its LPS core to interact with hDC-SIGN and mSIGNR1 receptors, leading to the invasion of APCs in vitro and in vivo. We therefore hypothesized that the dissemination of Y. pseudotuberculosis to the MLNs, spleens, and livers would also be a result of this host-pathogen interaction. Subsequently, shielding the exposed LPS core of Y. pseudotuberculosis grown in vivo at 37°C should reduce the dissemination of the bacteria to MLNs, spleens, and livers.
(i) Higher numbers of rough than smooth Y. pseudotuberculosis bacteria were disseminated to MLNs, spleens, and livers. To achieve a Y. pseudotuberculosis strain producing smooth LPS in vivo, we introduced plasmid pAY100.1 into strain Y1. Plasmid pAY100.1 carries the O-ag gene cluster of Y. enterocolitica serotype O:3 and produces the O-ag irrespective of the growth temperature (31, 32, 34–36). As a control, the plasmid vector pBR322 was transformed to Y1. Mice were infected via the orogastric route with Y1/pBR322 and Y1/pAY100.1 bacteria and sacrificed after 72 h. MLNs, livers, and spleens were then recovered and homogenized. The dissemination rates of the bacteria into the different organs were calculated by counting CFU. Figure 10A and C shows that higher numbers of Y1/pBR322 than Y1/pAY100.1 bacteria were isolated from the MLNs, spleens, and livers. Importantly, no differences in bacterial numbers were observed between the intestinal lumens of Y1/pBR322- and Y1/pAY100.1-infected mice (Fig. 10D). In addition, both strains exhibited no differences in growth and adhered to both HeLa and CHO cells equally well (data not shown).
Dissemination of Y. pseudotuberculosis was inhibited when covered with O-ag. Mice were infected orogastrically with 108 CFU of Y1/pBR322 or Y1/pAY100.1, and bacterial loads in the spleens, livers, and MLNs were quantified at 72 h postinfection. (A) For CFU counting, the homogenized samples of organs were spread on LB agar to recover the bacteria. Each circle represents the data obtained for one infected mouse, and horizontal boldface lines indicate the median values. *, P < 0.05. (B) Eight hours after inoculation in the real-time PCR assay, the absolute numbers of bacteria were determined from standard curves of serial dilutions of Y1 chromosome DNA. Values obtained from three independent measurements represent Y1/pAY100.1 DNA extracted from total tissue relative to that of Y1/pBR322. ***, P < 0.001. (C) After infection with Y1/pBR322-mCherry or Y1/pAY100.1-mCherry, mice were sacrificed and the spleens, livers, MLNs, and intestine were isolated for detection with the IVIS system, as shown in panel D. **, P < 0.005.
(ii) Higher quantity of bacterial DNA was recovered from MLNs, livers, and spleens of mice infected with rough than with smooth Y. pseudotuberculosis.The mice were challenged as described above, but the mice were sacrificed after 8 h of infection. The Y. pseudotuberculosis-specific DNA in MLNs, livers, and spleens was quantitated using ail gene-specific real-time PCR. In all tissues the relative amount of bacterial DNA was higher in Y1/pBR322- than in Y1/pAY100.1-infected mice (Fig. 10B), supporting the results of bacterial numbers described above.
In summary, the results suggest that Y. pseudotuberculosis could utilize its LPS core to interact with CD209 to enhance dissemination to the host tissues.
Blocking of the LPS core CD209 interaction with mannan or dextran oligosaccharide reduces the infectivity of Y. pseudotuberculosis.The LPS core CD209 interaction in E. coli can be blocked in vitro by several oligosaccharides, including mannan (14). Given that the interactions reported above were mediated by the LPS core oligosaccharide, we hypothesized that shielding the exposed LPS core with CD209-interacting oligosaccharides could reduce the bacterial infectivity in a murine model. To this end, we tested the influence of mannan and dextran oligosaccharides on the infectivity of the wild-type and fully virulent Y. pseudotuberculosis strain YPIII (37). The body weights and the mortality of the mice were monitored. The results clearly demonstrated that both the body weight loss (Fig. 11A) and mortality rate (Fig. 11B) of mice infected with YPIII in the presence of mannan or dextran oligosaccharides were significantly reduced. It should be noted that the growth rate of the Y. pseudotuberculosis YPIII bacteria was not influenced by the mannan oligosaccharide, as is the case with other Gram-negative bacteria (14, 26, 33).
Blockage of the host-pathogen interaction with certain oligosaccharides reduces the infectivity by Y. pseudotuberculosis. After culture at 37°C, wild-type Y. pseudotuberculosis strain YPIII (37) bacteria with or without mannan or dextran were inoculated into mice by following procedures described in Materials and Methods. The rates of body weight loss (A) and mortality (B) were recorded every 12 h up to 156 h postinfection. Student's t test was used to determine significant differences in both body weight and death of mice by the wild-type Y. pseudotuberculosis YPIII with and without oligosaccharides, mannan, and dextran. *, P < 0.001.
In conclusion, these results might help us understand how and why oligosaccharide-based prevention methods and treatments for certain diarrheal infections work.
DISCUSSION
Y. pseudotuberculosis is able to disseminate and infect MLNs (10). However, the molecular mechanisms involved in dissemination of Y. pseudotuberculosis to MLNs remained to be determined. In this work, we demonstrate that the interaction between LPS core oligosaccharide and CD209 receptors may contribute to this dissemination.
O-ag is a well-documented virulence factor for Y. pseudotuberculosis, but O-ag production was almost fully suppressed in bacteria grown at 37°C (17–19), suggesting that during infection the LPS core oligosaccharide of the bacteria was exposed (Fig. 1). Why would Y. pseudotuberculosis restrain the expression of its virulence factor during infection? Based on the evidence presented in this work, we speculate that after penetration through the mucosal membrane of the small intestine, perhaps not via Peyer’s patches (Fig. 2), Y. pseudotuberculosis intentionally represses O-ag production. This exposes the LPS core oligosaccharide to interact with CD209. As a result, the bacteria invade the APCs and are carried by the infected APCs to lymph nodes, spleen, and liver, facilitating the bacteria to colonize these tissues and establish the host infection.
Thus, an important corollary to this study is that some pathogens, such as Y. pseudotuberculosis, have evolved mechanisms for exploiting the very host defenses designed to eliminate them, with the result being an expanded ability to disseminate. Our unpublished data also indicate that similar to Y. pseudotuberculosis, Salmonella, but not Shigella, is able to modify its LPS during infection. Consequently, Salmonella is also able to hijack the APCs in a manner similar to that of Y. pseudotuberculosis.
Certain technical issues need to be discussed here. First, three identified virulence factors mediate interactions between Y. pseudotuberculosis bacteria and host cells (21, 23, 27), one of which is invasin. As shown in Fig. 4, Y. pseudotuberculosis cultured at 26°C interacts with HeLa and CHO cells at a high level, but this interaction was reduced when Y. pseudotuberculosis was cultured at 37°C, since the expression of invasin at this temperature is suppressed (28). On the other hand, it appears that invasin does not participate in or influence the interaction between Y. pseudotuberculosis and dendritic cells, because Y. pseudotuberculosis cultured at 37°C invades DCs, but the invasion of DC by Y. pseudotuberculosis cultured at 26°C is dramatically reduced.
Besides the integrin-invasin interaction, Y. pseudotuberculosis promotes another hDC-SIGN- or mSIGNR1-independent interaction with HeLa and CHO cells (Fig. 4 and 6). We have observed that this DC-SIGN-independent interaction appears to rely on the Ail protein of Yersinia, which may involve the heparan sulfate proteoglycan (our unpublished observation) and other binding proteins of fibronectin (38), C4b-binding protein (39), and vitronectin (40). Fortunately, this interaction can be inhibited by heparin, a synthetic form of heparan sulfate (31). This is also the reason for the inclusion of heparin in the experiments intended to observe the interaction between Y. pseudotuberculosis and HeLa or CHO cells (Fig. 4 and 6).
We showed that a clear inhibition was obtained from transfectants (Fig. 7) but not in primary cells (Fig. 8). Only the triple reagents of inhibitors (antireceptor antibodies, mannan oligosaccharide, and purified LPS core) employed were able to partially inhibit the interactions of hDCs with Y. pseudotuberculosis. There might be many reasons or factors involving the interaction in primary cells. (i) As described above, we believe the interaction between LPS core carbohydrates and C-type lectins results from nonspecific bindings, i.e., while some cell lines are capable of these interactions, primary cells are not. (ii) Human DCs also expressed langerin (CD207), another receptor for HIV, which was also a receptor for the LPS core (32). (iii) DCs are very dynamic cells that phagocytose everything they encounter.
We have suggested that suppression of O-ag expression in Y. pseudotuberculosis enhances its virulence, but the fact is that the expression of O-ag is absolutely necessary for the pathogenicity based on the recovery of a number of O-ag gene cluster mutants in signature-tagged mutagenesis experiments (41). Therefore, we used the Y. pseudotuberculosis strain Y1, grown at 26°C and at 37°C, instead of the PB1 and PB1Δwb strains to examine the LPS core CD209 interaction-mediated in vivo dissemination (Fig. 10). For this reason, this study only indicates that in Y. pseudotuberculosis the O-ag expression is repressed during certain stages of the infection and/or in different tissues.
DC-SIGN (CD209), langerin (CD207), and DEC-205 (CD205) have been shown to be receptors for the LPS core ligand of several Gram-negative bacterial species, thereby promoting bacterial adherence and phagocytosis (14, 26, 31–34). The biological significance of the host-pathogen interaction has been poorly understood and ill-defined. The present study provides the first instance of a definition of this interaction and its possible biological significance, which may contribute to future studies in various fields, as shown below.
Salmonella spp. rather than Shigella spp. are able to disseminate to other parts of mammalian organs and cause systemic infections. Ongoing studies in the laboratory indicate that like Y. pseudotuberculosis, Salmonella spp., but not Shigella spp., are able to modify their full O-antigen-expressing LPS into O-antigen deletion core LOS during infection. Consequently, Salmonella spp. (data not shown) are able to hijack the APCs similarly to the infection caused by Y. pseudotuberculosis, as described in this study. As shown in our previous report, S. enterica serovar Typhimurium utilizes its core LOS to interact with human DC-SIGN, resulting in phagocytosis by host cells (14). Interestingly, a recent report indicated that Shigella spp. are able to disseminate if the expression of O-antigen or O-antigen-expressing capsule is genetically modified (42). It should be recognized that the previous report categorized results for Shigella and E. coli as being from a single species.
The most significant contribution of this study is to reveal a possibly new molecular mechanism of several persistent infections, including urinary tract infection (UTI) by E. coli, Gram-negative bacterium-associated Crohn’s disease, typhoid fever, Helicobacter pylori-associated chronic atrophic gastritis (ChAG), and chronic infection caused by Klebsiella spp. Although the expression of O-antigen protects the Gram-negative bacterial pathogens from phagocytosis and serum killing, the core LOS-expressing bacteria (rough strains), such as enterohemorrhagic E. coli (EHEC), uropathogenic E. coli (UPEC), Salmonella spp., Helicobacter pylori, Shigella sonnei, and Y. pseudotuberculosis, are isolated from clinical samples (14, 26). We expect that the loss of O-antigen or modification of LPS during infection causes the Gram-negative bacteria to become less virulent but readily phagocytosed by APCs. Thus, the phagocytosed bacteria may hide themselves from attacks of various host clearance systems, as shown in Salmonella (43). Mounting data have shown associations among APCs, C-type lectin CD209s, LPS, and persistent infections caused by the Gram-negative bacterial pathogens described above. Hopefully, the data presented in this work will add to the collective understanding.
Y. pseudotuberculosis is an ancestor of several Gram-negative bacteria (7–9, 44, 45), can live and replicate in various host niches (46), and causes different clinical manifestations (47). Studies of this pathogen during infection may generate a broad impact in understanding the pathogenesis of bacterial pathogens in general. A new technology, called dual RNA sequencing (RNA-seq), for monitoring the transcript profiles of pathogens and hosts during infection has been developed (48). This technology has been used for profiling S. enterica serovar Typhimurium (49), Haemophilus influenzae (50), and Mycobacterium tuberculosis (51); these profiles were limited to in vitro studies only. With Y. pseudotuberculosis as the model strain, Nuss et al. further established a fast, generic tissue dual RNA-seq approach, which allows a broad and instantaneous monitoring of gene expression that links the infected hosts and the colonizing pathogens in in vivo infection (52). As a result, they first found that one of the main strategies for bacterial survival during infection was to prevent pathogens from phagocytic attacks (52). Second, they discovered that Yersinia germs can also reduce the production of toxins that induce the inflammation of the afflicted tissues during infection. Therefore, the reduction of inflammation allows bacteria to escape attacks from the host immune system (53). This process is now named “bacteria persist as stowaways” (https://health.economictimes.indiatimes.com/news/industry/bacteria-persist-as-stowaways-hzi/62836896). The toxin described here could be the O-antigen of Y. pseudotuberculosis.
In summary, because this host-pathogen interaction is not restricted to one species, the findings presented here may contribute to future, more broad studies, as also illustrated in the last sentence of a 2006 report (14): “From an evolutionary point of view, the interaction of bacterial core LOS/LPS and the innate immune receptor, DC-SIGN, may represent a primitive interaction between microbial pathogens and the professional phagocytic host cells.”
MATERIALS AND METHODS
Human and animal studies.All animal procedures and human experiments were carried out in strict accordance with the Institutional Animal Care and Use Committees (IACUCs) and Institutional Review Board (IRB) of Tongji Hospital, Tongji Medical College, Tongji, China. The handling of the mice and all experimental procedures were specifically approved for this study by the Medical Ethics Committee of Tongji Hospital and were conducted in accordance with institutional guidelines (IRB identifiers TJ-A20141220 for animal experiments and TJC20140113 for human experiments). All procedures on mice were performed under sodium pentobarbital anesthesia, all efforts were made to minimize suffering, and all volunteers involved in the experiment signed informed consent.
Bacterial strains.E. coli K-12 strain CS180 produces a rough LPS missing O-ag (54) (Table 1). CS1861 is a derivative of CS180 harboring pSS37, a plasmid containing all of the genes for O-ag expression from Shigella dysenteriae 1 (54–56) (Fig. 1). E. coli strains were cultured on Luria-Bertani (LB) medium supplemented with 1.5% agar at 37°C overnight. Y. pseudotuberculosis Y1 is a serotype O:1a strain lacking the virulence plasmid (pYV). This strain originates from the CDC and has been used as a positive invasion control previously (57–59). We also used the Y. pseudotuberculosis O:1a wild-type strain PB1 (60) and its rough isogenic derivative, the PB1Δwb strain, which is unable to produce O-ag due to deletion of the whole O-ag gene cluster (29). Constructions of inv- and ail-deleting mutants for PB1 are also shown in Table 1. These strains were grown and maintained in a manner identical to that for E. coli K-12. The Yersinia strains described above were virulence plasmid-cured strains, selected using a combination of magnesium oxalate and Congo red selection methods (61). However, Yersinia pseudotuberculosis serotype O:3 strain YPIII is a wild-type and fully virulent strain (37) and contains the virulence plasmid.
Bacterial strains and cell lines used in this study
Construction of Y. pseudotuberculosis that expresses O-ag at 37°C.The lack of O-ag at 37°C in Y. pseudotuberculosis is due to repression of the O-ag biosynthetic genes (17–19) (Fig. 1). Y. pseudotuberculosis strain Y1 was transformed with plasmid pAY100.1, which carries all of the necessary genes for the expression of the O-ag of Y. enterocolitica serotype O:3 (35, 36). The expression of O-antigen, coded for by pAY100.1 plasmid, is not influenced by growth temperature (31, 32, 34). Therefore, this mutant is still able to express a full LPS even at 37°C.
Construction of Y. pseudotuberculosis PB1 and PB1Δwb strains with inv and ail gene knockout.We used two steps to construct the inv- and ail-deleted mutants. First, to knock out the ail gene of Y. pseudotuberculosis, the suicide plasmid PCVD442-ail::KmGB was mobilized into the Y. pseudotuberculosis PB1Δwb strain, as described previously by Ho et al. (62) and our laboratory (unpublished data). Briefly, the suicide plasmid in E. coli S17-1λpir was introduced into the parental Y. pseudotuberculosis PB1Δwb strain by conjugation. The Kanr transconjugants were selected using a Yersinia selective agar plate with cefsulodin-irgasan-novobiocin (CIN) agar for counterselection of the donor. The selected transconjugants then were plated onto LB agar with 10% sucrose and grown at room temperature for 2 days. The correct allelic exchange in the resultant Sucr Kanr colonies was confirmed using PCR with corresponding primers ailrf1 (5-TCAATGGGGCTATTGATTTCG-3) and ailr1 (5-GGTGACTTGCTCGAAATAATG-3) (63). Replacement of Ail with a cassette results in a complete deletion of the ail gene. The deletion of the ail gene from the mutants resulted in the PB1ΔwbΔail strain.
For generating the inv knockout strain, the CRISPR-Cas12a system was used to delete the inv gene from the Y. pseudotuberculosis PB1Δail and PB1ΔwbΔail strains, as described previously (64, 65). Briefly, the protospacer adjacent motif (PAM) TTG, a short DNA sequence (3 to 5 bp) adjacent to the protospacer (target, 25 nucleotides [nt]) site, was selected in the coding sequence of inv. Two complementary oligonucleotides (crRNA-inv top and crRNA-inv bottom) containing the protospacer sequence (adjacent to 5′-TTG-3′) were synthesized, annealed to yield a protospacer cassette with BsaI overhangs at the 5′ and 3′ ends, and then cloned into the crRNA expression plasmid pAC-crRNA-Cm to generate the recombinant plasmid pcrRNA-inv-Cm. A single-stranded DNA (ssDNA) oligonucleotide (inv oligonucleotide for lagging) with 40 nt of flanking region sequence identity on both sides of the mutation site was synthesized, in which 3 termination codons (TAA TGA TAG) and a 22-nt random sequence were introduced between the 2 flanking regions. Cotransformation of the ssDNA oligonucleotides and the recombinant plasmid pcrRNA-inv-Cm into Y. pseudotuberculosis PB1Δail and PB1ΔwbΔail cells harboring pKD46-cpf1(Cas12a) was performed, and samples were plated on LB supplemented with 100 μg/ml ampicillin and 30 μg/ml chloramphenicol and incubated at 26°C. Single colonies were plucked to inoculate LB medium supplemented with appropriate antibiotics at 26°C. We performed PCR on the target gene regions with corresponding primers to screen preliminarily and sent the PCR products for sequencing to verify the PB1ΔailΔinv and PB1ΔwbΔailΔinv clones. Finally, the pcrRNA-inv-Cm plasmid and pKD46-cpf1 plasmid were cured by incubation on an LB plate with 7% sucrose and incubation in LB medium at 42°C with shaking overnight, respectively.
Biochemical and cellular biology reagents.Mannan oligosaccharide (M-7504) and dextran oligosaccharide (CAS; 9004-54-0) were purchased from Sigma-Aldrich (St. Louis, MO) and Aladdin (Shanghai, China), respectively. Anti-human DC-SIGN and mouse SIGNR1 monoclonal antibodies (MAbs) were purchased from Pharmingen (San Diego, CA). LPS core of Neisseria gonorrhoeae was purified as described previously (66). The bacteria were suspended in water and heated to 65°C. Equal volumes of phenol heated to 65°C were added to the bacterial suspensions, and the mixture was incubated at 65°C for 1 h with stirring. After centrifugation, the aqueous phase was recovered and the interfacial/phenol phase material was reextracted once with water. Aqueous phases were ultrafiltered three times through a 100-kDa ultrafiltration device (Millipore), ultracentrifuged at 100,000 × g for 6 h, and lyophilized.
Mice.C57BL/6, BALB/cJ, and LTβR-1 KO mice in the C57BL/6 background (25) were bred in the animal facility of UIC–College of Medicine and Tongji Hospital or purchased from Wuhan University Animal Center. Mice were housed in animal facilities at the UIC–College of Medicine and Tongji Hospital in direct accordance with guidelines drafted by the Animal Care Committees of UIC–College of Medicine–Rockford and Tongji Hospital. The peritoneal macrophages express high levels of SIGNR1 (67, 68), as shown in Fig. 9B.
Preparation of DCs.Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats obtained from human blood donors by density gradient centrifugation over FicollPaqueplus (1.077 g/ml; Pharmacia, Piscataway, NJ). Blood was loaded in a 1:1 (vol/vol) ratio on Ficoll and centrifuged without braking for 30 min. PBMC were washed 4 times with phosphate-buffered saline (PBS), and monocytes were purified from PBMC using CD14 microbeads (Miltenyi Biotec, Auburn, CA), as previously described (69). To increase purity, cells were passed over a second CD14 microbead column. The final purity of the isolated monocytes was >98%, as assessed by labeling with CD14-fluorescein isothiocyanate (FITC) antibody (Caltag, Carlsbad, CA) and flow cytometric analysis. Purified CD14+ monocytes (5 × 105 cells/ml) were cultured for 6 days to promote differentiation of immature monocyte-derived DCs (MDDCs) in culture medium consisting of RPMI 1640 (BioWhittaker, Walkersville, MD), 10% heat-inactivated fetal bovine serum (FBS) (HyClone, Logan, UT), 100 U/ml penicillin, and 100 μg/ml streptomycin in the presence of 20 ng/ml recombinant human granulocyte macrophage colony-stimulating factor (Immunex, Seattle, WA) and 10 ng/ml recombinant human interleukin-4 (Peprotech, Rock Hill, NJ). The DCs derived from these cultured monocytes display typical dendrites, and in mixed lymphocyte cultures they promote activation of alloreactive T cells. The phenotypes of these cells are HLA-DR+, CD1a+, CD86+, CD40+, and CD14− (69). Upon LPS stimulation, these DCs express CD83 (70). We have utilized this protocol for identification of DC-SIGN as a receptor for core LPS of several Gram-negative bacteria and to explore how N. gonorrhoeae enhances HIV infection (14, 26, 31, 66).
Isolation of mouse peritoneal macrophages.After the mice were euthanized, the abdomens of mice were immediately exposed, cleaned with 70% ethanol, and opened with scissors. Five milliliters of RPMI was injected into the intraperitoneal cavity. Mouse abdomen was gently massaged for 2 min, and then the lavage fluid was collected. The suspension containing the macrophages was seeded onto 6-well plates, in which each well contained a 1.5-cm-diameter glass coverslide, and placed in a CO2 incubator for 2 h. The cell layers were washed 3 times to remove nonadherent cells. Macrophages were then removed from the plastic surface by incubation with citrate saline and reseeded for interaction assays.
Cell lines.HeLa-hDC-SIGN cells were generated by transfecting HeLa cells with human DC-SIGN cDNA, followed by selection for stable surface DC-SIGN expression, as originally described (71) (Table 1). The cell lines were recently used for identification of core LPS from several Gram-negative bacteria as the ligand for the DC-SIGN receptor (14, 26, 33).
Mouse C-type lectin transfectant, CHO-mSIGNR1, was generated by transfecting CHO cells with mouse SIGNR1 cDNAs, followed by selection for stable surface expression as originally described (67). CHO-NEO is a control cell line which expresses the neomycin resistance gene only.
Adherence and phagocytosis assays.The adherence and phagocytosis assays were carried out as described previously (59, 72). Briefly, host cells (HeLa, CHO, dendritic cells, and human and mouse macrophages) were plated in 24- or 96-well plates. Cells were suspended in RPMI with 2% fetal calf serum (FCS) at a concentration of 4 × 105/ml. Aliquots (0.5 ml each) of these cell suspensions of were added to 24-well plates, and after addition of 50 μl of bacterial suspensions at a concentration of 1 × 107 CFU/ml, the cells were allowed to incubate for 2.5 h (2 h for dendritic cells and alveolar macrophages) at 37°C in the presence of 5% CO2. The cell monolayers were then washed 3 times with PBS. The number of associated bacteria (adherent and internalized) per cell was quantified by washing the cells 3 times with RPMI containing 2% FCS and plating the culture after the cells were lysed by 0.5% saponin (Calbiochem Corp., San Diego, CA).
To determine the internalization of bacteria, gentamicin, which kills extracellular bacteria but cannot penetrate into host cells, was added into each well to a final concentration of 100 μg/ml, and the cultures were incubated for 60 min. Cells were washed twice to remove the antibiotic (for DCs, a cytospin was necessary during the washing, since DCs do not attach to plastic wells). Cells were suspended in PBS containing 0.5% saponin, diluted, and plated on GC or LB plates. The level of internalization of bacteria in these host cells was calculated by determining the CFU recovered from lysed cells. All experiments were performed in triplicate, and data are expressed as means ± standard errors.
Determination of phagocytosis by flow cytometry.The following method was used to supplement the survival-based phagocytosis assay described above, since DCs kill some phagocytosed bacteria, such as Neisseria gonorrhoeae (14, 33, 34). Measurement of the phagocytosis rate of bacteria by DCs was performed as follows. Briefly, bacteria were suspended in RPMI medium containing 5- and 6-carboxyfluorescein diacetate-succinimidyl ester (CFDA-SE; Molecular Probes, Eugene, OR) for 40 min and washed 2 times with RPMI to remove the excess dye. Labeled bacteria were added to DC cultures for 2 h. Cell cultures were washed 2 times to remove unbound bacteria. DCs plus associated bacteria were fixed with 2% paraformaldehyde. Before flow cytometry, a 1:10 dilution of Trypan blue (0.4%, Sigma, St. Louis, MO) was added to the fixed cell cultures, and the mixture was incubated at ambient temperature for 10 min (33) to quench the fluorescence from extracellular labeled bacteria. Trypan blue blocks fluorescence but cannot penetrate host cells; therefore, fluorescence from internalized bacteria will not be influenced by addition of Trypan blue. The rate of bacterial internalization was determined by comparing the percentage of fluorescence-positive DCs with that of DCs interacting with unlabeled bacteria.
In vivo phagocytosis assays for peritoneal macrophages.The protocol for the in vivo phagocytosis assay is derived from a similar procedure from our previous studies on alveolar macrophages (34). In detail, 1 ml of bacterial suspension (optical density at 600 nm [OD600] of 0.1) was injected into the mouse intraperitoneal cavity. Mouse abdomen was gently massaged for 1 min. After 1.5 h, mice were euthanized, another 4 ml of RPMI with 2% FCS was immediately injected into each mouse intraperitoneal cavity, and the abdomen was gently massaged for another 1 min. The intraperitoneal fluids or exudates were collected, and the numbers of cells were counted for each collection of intraperitoneal lavage. A total of 1 × 106 cells were seeded onto each well of 24-well plates, containing RPMI with 2% FCS and gentamicin at a concentration of 100 μg/ml, and were then incubated for 1.5 h to allow the macrophages to adhere to plates and kill the extracellular bacteria. Each well was washed three times with RPMI with 2% FCS to remove nonadhered cells and lysed with saponin by following the same procedures as those for the in vitro phagocytosis assays described above.
Animal challenging for dissemination and infection.C57BL/6, BALB/cJ, and LTβR-1 KO mice in the C57BL/6 background (25) were used in the following experiments. The dissemination rate was defined as the transport of Y. pseudotuberculosis to MLNs, livers, and spleens of the mice. The infectivity was defined as the body weight loss and the mortality after inoculations of pathogens.
In detail, mice were inoculated with Y. pseudotuberculosis at an OD600 of 1.0 in phosphate-buffered saline (0.3 ml) via the orogastric route with a catheter. In experiments with strains Y1/pBR322 and Y1/pAY100.1, mice were injected intravenously with 50 μg/g ampicillin on each of the following days. At 72 h postinoculation, mice were euthanized and MLNs, livers, and spleens were collected and homogenized. It should be noted that MLNs isolated here included whole mesentery tissues. (i) For CFU determination, the homogenized organs were lysed with 1% Triton X-100 to release the bacteria 10 min before they were plated onto LB agar containing ampicillin. The numbers of CFU per organ were determined as described previously (34). (ii) For real-time PCR assay, after 8 h of inoculation, total DNA was isolated from the tissue-homogenized samples recovered from mice infected with Y. pseudotuberculosis. A standard dilution series of purified genomic Y. pseudotuberculosis DNA at concentrations of 108, 107, 106, 105, 104, 103, 102, 10, and 1 copies/µl was used for quantification. The standard dilution series was included in all PCR runs. Primers amplified a 157-bp fragment from the ail gene and were the following: forward, CGTCTGTTAATGTGTATGCCGAAG; reverse, GAACCTATCACTCCCCAGTCATTATT. The real-time PCR was performed with a SYBR Green master mix and detected with a LightCycler (73). The threshold cycle of each sample was measured for two replicates, and the DNA concentrations were calculated using the LightCycler software. (iii) For in vivo imaging, Y1/pBR322-mCherry and Y1/pAY100.1-mCherry, derived from Y1/pBR322 and Y1/pAY100.1, respectively, were used. The IVIS Spectrum in vivo imaging system detected the mCherry fluorescent protein with filters covering its excitation and emission wavelengths at 587 nm and 610 nm. To better define the infected areas, the individual organs, instead of whole mouse body, were collected and detected under the imaging system. Two points should be noted. First, 30 min before inoculation, mice were injected with ampicillin at a final concentration of 50 μg/g of mouse body weight to maintain the plasmid-based expression of O-antigen in Y1/pAY100.1. Second, the Y. pseudotuberculosis strains used in this study were cultured at 26°C in order to get effective invasion of mucosal surfaces. As mentioned in Discussion, the expression of invasin is inhibited at 37°C (28). (iv) For the animal challenge assay, after growth at 37°C, wild-type Y. pseudotuberculosis YPIII, pretreated with and without oligosaccharides, was inoculated at an OD600 of 0.2 in a manner similar to that described for the in vivo dissemination assay. The rates of body weight and death of the mice were recorded every 12 h up to 156 h postinfection.
Statistical analyses.All statistical analyses were completed using Prism software, version 6 (Graph Pad, San Diego, CA, USA). Statistical significance was assessed using Student’s t test for the univariate analysis of two sets of data and two-way analysis of variance (ANOVA) for multiple comparisons; for mouse survival experiments (Fig. 11B), we used the log-rank test.
ACKNOWLEDGMENTS
This work was supported by a PHS grant (R01AI 47736 to T.C.) for work performed at the University of Illinois at Chicago and by grants from the National Natural Science Foundation of China (NSFC 81271780 and 81471915) and two local grants from Tongji Hospital, Tongji Medical College, to T.C. C.G.P. was supported by grants from the National Research Foundation of Korea (NRF-2013R1A1A2058427 and NRF-2014R1A4A1008625) and a faculty research grant of the Yonsei University College of Medicine for 2014 (6-2014-0062).
We thank Olivier Schwartz at Pasture Institute, Paris, and Joseph Hinnebusch at the Rocky Mountain Laboratories, NIH, for their long-term support and help to initiate the project regarding DC-SIGN and Yersinia species interactions. We are indebted to Ralph Steinman when he was at the Rockefeller University for his insightful advice and generous financial support for this project. Finally, we thank the Tongji Hospital, HUST, for their support and allowing this project to continue. We do not have a commercial or other association that poses a conflict of interest.
FOOTNOTES
- Received 27 August 2018.
- Returned for modification 17 September 2018.
- Accepted 9 October 2018.
- Accepted manuscript posted online 22 October 2018.
Supplemental material for this article may be found at https://doi.org/10.1128/IAI.00654-18.
- Copyright © 2018 American Society for Microbiology.
