TABLE 1.

Primers used in this study

PrimerSequence (5′-3′)Reference
1CGGGATCCGCTGCGGTAGTGGATGCATAGGThis work
2GCTCTGATAAATATGAACATGATGAGTGATCGGGCCATAGTGGAGCTGTTCTGC
3CTGCATCCCTTAACTTGTTTTTCGTGTGTCTAGATTGAGTGGGAAGCAACACCAACThis work
4CCTAGCTAGCTTGCGTTTTTCCCTTTGATTTTAGA
IIIATATCTAGAAAATTCTATCATAATTGTGGTTTCAA43
IVCTATCTAGAGGTACTAAAACAATTCATCCAGTAAA
ST1GTTGGATCCAGAATGTTTAGCAGAAGa3
ST2TTCTCTGCAGTTTCTATGCTTGTAATb
ST3CAAAAAAGCGGAATTGAAGCAG3
ST4GAATATTGACTTTTGTTGGCCG
49CTAGTGGGTACAGAATTAATCGAGC11
50TAACATAAAAATATCCTCCTTGC
R/SpPROT1SAGGAGAAAGGTACCCATGATACAAGCATACGAAATTGCACAThis work
R/SpPROT1EndAGACGTCGGATCCGGCCTGTTGAGCTAAGCAATAACA
relBbu 6kbLGGCTGGAACAGGTGGAGAAGAAGThis work
relBbu 6kbRTGTGCAGCAATGATGGTCTTCAG
BB0199RT_FGTACAATCTATATCGTGATGAATCTATACCCThis work
BB0199RT_RGGTTGATATTGCTAGGTATTTAAGTTGTCTG
  • a The BamHI restriction site sequence is underlined.

  • b The PstI restriction site sequence is underlined.