TABLE 2.

Oligonucleotides used in this study

NameSequence (5′-3′)aPurposeLocation relative to SchuS4 genome (bp)
wbtD FACGCGTCGACTCCAAATGTAACAGGCTTAGDisruption cassette cloning; used to make Southern blot probe1512972-1512953
wbtD RGTGAAAGTTGGAACCTCTTACAGATCTACGTGCATTTTGCTGTAAGTATGCATTGACDisruption cassette cloning; used to make Southern blot probe1512219-1512242
wbtF FGATGAGTGGCAGGGCGGGGCGTAAAGATCTTGCACGGCTTACGATAATGTTAAATTTCDisruption cassette cloning1510886-1510864
wbtF RACGCGTCGACATTAATTAAATACCACTCAACAGCDisruption cassette cloning1509920-1509943
wbtE FTAGTAGTAGACGCAGGAGUsed to make Southern blot probe1511621-1511604
wbtE RAGCTGCCTTGTACGTTAGUsed to make Southern blot probe1511365-1511382
Cam FGCACGTAGATCTGTAAGAGGTTCCAACTTTCACUsed to make Southern blot probe
Cam RCGTGCAAGATCTTTACGCCCCGCCCTGCCACTCATCUsed to make Southern blot probe
wbtF FCTAATGAAGAGTGGGCGAGACPCR1510407-1510387
wbtF RTATCACCCGCTCTATCTGGACPCR1510030-1510050
wbtG FCCTTAACCAAGGTGGTGCTGAAPCR1508645-1508624
wbtG RACTCCCCTACCCATAAGTGAPCR1508544-1508563
wbtH FCTGAGCATGCAAGAGCAGTAGPCR1506655-1546635
wbtH RATCACCAGCGTCACCTGATAGPCR1506450-1506470
wbtM RGCATAACGCCAATCATGTCCPCR1500120-1500074
2FTGTCTTAGATATGGGGCAACCPCR1515021-1515001
2RACAAATATCAAATCCTAACACATCPCR1512073-1512096
3FTAGAAGCAGCTGCGATAGGTAGACPCR1512463-1512440
ISFtu2 FATGAATTATCATATAAAAGAAGTATTCPCR1517296-1517250
GroES prom FGTACGTGCACAATAAACATCGCAAAAGGTGTAConstruction of pSMP221763632-1763653
GroES prom RACTTGATCATCGGTACCCATAACAATCTTACTCCTConstruction of pSMP221763983-1763966
SacB FTACCGTACGATGAACATCAAAAAGTTTGCAConstruction of pSMP22; amplification of sacB from pRL271 (GenBank accession no. L05081)
SacB RTGCCGTACGTTATTTGTTAACTGTTAATTGConstruction of pSMP22; amplification of sacB from pRL271 (GenBank accession L05081)
  • a SalI sites are in boldface; cat sequences are underlined.