TABLE 1.

Primers used for detection of E. coli virulence factor genes and the phase switch position

Virulence factorGenePrimer sequence (5′-3′)Primer designationaSize of PCR product (bp)Reference
fimH adhesinfimHTGCAGAACGGATAAGCCGTGGFimHf50625
GCAGTCACCTGCCCTCCGGTAFimHr
P fimbriaepapCGACGGCTGTACTGCAGGGTGTGGCGpap 132829
ATATCCTTTCTGCAGGGATGCAATApap 2
papG adhesin
    Class IpapGTCGTGCTCAGGTCCGGAATTTj96-193f46124
TGGCATCCCCCAACATTATCGj96-653r
    Class IIpapGGGGATGAGCGGGCCTTTGATia2-383f19624
CGGGCCCCCAAGTAACTCGia2-572r
    Class IIIpapGGGCCTGCAATGGATTTACCTGGprs-198f25824
CCACCAAATGACCATGCCAGACprs-455r
S fimbriaesfaDCTCCGGAGAACTGGGTGCATCTTACsfa 141029
sfaECGGAGGAGTAATTACAAACCTGGCAsfa 2
Dr hemagglutinindraAGCCAACTGACGGACGCAGCACDr-321f22932
CCCCAGCTCCCGACATCGTTTTTDr-550r
fim switch regionInvertible DNA elementGAGAAGAGGTTTGATTTAACTTATTGA55940
AGAGCCGCTGTAGAACTGAGGB
  • a f, forward; r, reverse.