TABLE 1.

Mini-Mu transposition insertion mutants in S. aureus S30 showing significantly defective biofilm formation after 6 h growth on polystyrene plates

S30 Em-Mu mutantNCBI gene identificationN315 locus tagaGene name(s)Gene product(s) or domain similarity(ies)Insertion site sequencebEm-Mu orientationcPIAdWTAe
Ω810515926180SA0461 mfd Transcription-repair coupling factorTTTCATACGTTTCTTTCAAATCATTGCGCA±+
Ω746215926315SA0594 tagGH Intergenic region between tagH (teichoic acid translocation ATP-binding protein) and tagG (teichoic acid translocation permease)ATGATTGTATACTATAATGTATTTGTAATA++
Ω33215926363SA0641 mgr/norR/rat Transcriptional regulator, MarR familyGTTAGATTGTACTTCTTAAAAACTTTGTTA±+
Ω793715926423SA0701 bfd1 HPf, GGDEF domainCTTAGGTAATGTAAAAGAATTTGATAGTAC±+
Ω913515926604SA0874 bfd2 HP, similar to multidrug resistance protein, major facilitator familyTTGCATGGATATTATATTATTTTGTCGATG±+
Ω797115926643SA0909 fmtA Autolysis and methicillin resistance-related proteinTCCATGGTTTAAAACATCTAAGCCTATCCC
Ω763915926643SA0909 fmtA Autolysis and methicillin resistance-related proteinAACAGTAAAGACTTGTCCAAAGAATCCCCC
Ω710515926643SA0909 fmtA Autolysis and methicillin resistance-related proteinACAACTACATACTTATCATTATAGTAAACA
Ω758615926675SA0940 bfd3 HP, predicted hydrolase of metallo-β-lactamase/β-CASP superfamilyGCCATTGAATATCTTTATTTTGATTTAACT±+
Ω569015926799SA1059 fmt Methionyl-tRNA formyltransferaseCCTAATACACTTAATTTATCATGCATCGTA+
Ω90415926804SA1064 bfd4 HP, similar to yjeQ (engC) GTPaseATGGTCGTATCTAAATTGCGCAATATTCCC+
Ω530015926833SA1093 bfd5 HP, similar to DNA topoisomerase I topAGCTACTAAAGAAACCGTCGATTACTTTCCT±+
Ω690015926838SA1098 codY GTP-sensing pleiotropic transcription repressorTTCTTCCAACATTTGAATAATTCTTTGACT+
Ω644115926858SA1118 bfd6 HP, predicted hydrolase of metallo-β-lactamase/β-CASP superfamilyGCAATGATAACTTCCATATTAGCAGAAGCC+
Ω110515926884SA1142 glpD Aerobic glycerol-3-phosphate dehydrogenaseGCCGCCTTTTAGACCTTCTTTTTTAACTAA±+
Ω81915926945SA1197 tyrA Prephenate dehydrogenaseGTTTTATTACTCAAGGTGATATCTTTCCAC+
Ω108415927073SA1323 srrA Staphylococcal respiratory DNA-binding response regulator SrrAATAATAATCGGTGTTTGTTTATGTTCACGC+++
Ω453615927656SA1885 bfd7 HP, predicted ATP-dependent RNA helicase, DEAD box familyGCAGGTAGCTGAACAATTAAGAGAATTTAG±+
Ω868615927656SA1885 bfd7 HP, predicted ATP-dependent RNA helicase, DEAD box familyATAGGCATACCACCGAATACAGTAACAACT±+
Ω754615927681SA1909 atpF ATP synthase β chainTTCAAGTTTCTGTGCATTTAACTTAGCTTG±
Ω134815928079SA2288 gtaB UTP-glucose-1-phosphate uridyltransferaseTTGGTTATCATTATTCATACGTTCAATCGC++
Ω341215928146SA2354 bfd8 HP, putative membrane acyltransferaseGTGATGAAATGAATCACTATCATAAGCTCC+
Ω693615928157SA2364 bfd9 HP, putative DNA binding TetR superfamily transcriptional regulatorTTCAATTCGTTGCCTATTCTCTTTTGCATC+
Ω468115928252SA2459 icaA Intercellular adhesion protein AACCATATTATATGATTGAGAATTTCAAACA+
Ω877915928252SA2459 icaA Intercellular adhesion protein AAATATGGTGCATCTTGATCAACGATAGTATNDND
Ω340815928252SA2459 icaA Intercellular adhesion protein ACTCAAACATCAAAATATATAAAGGAAACCTNDND
Ω59815928252SA2459 icaA Intercellular adhesion protein AATCGAGATGATTTGCTCAAACATCAAAATANDND
Ω251415928252SA2459 icaA Intercellular adhesion protein ATTTATANAAGTCATAGTAAATGATGATAGTNDND
Ω407915928253SA2460 icaD Intercellular adhesion protein DCAAAAGACACAAGATATAGCGATAAGCTGC+
Ω776215928253SA2460 icaD Intercellular adhesion protein DATTGTAAGAGAAACAGCACTTATCGCTATANDND
Ω818415928254SA2461 icaB Intercellular adhesion protein BCAGGCAATATGATCAAGATACTCAACACTA+
Ω813815928254SA2461 icaB Intercellular adhesion protein BCTGGCATTAAATTATCACCGTGTAAGAAAANDND
Ω850115928254SA2461 icaB Intercellular adhesion protein BGCTCAAAAGCATCATCACTAATTAATCTAANDND
Ω197415928255SA2462 icaC Intercellular adhesion protein CGCGTGCAAATACCCAAGATAACAATAAACA+
Ω531915928255SA2462 icaC Intercellular adhesion protein CACTGTAAAACAATCCCATTAATATGTAAGGNDND
Ω894515928255SA2462 icaC Intercellular adhesion protein CCTCAAAATAAAGAATTGCATGATAACAACGNDND
Ω596015928255SA2462 icaC Intercellular adhesion protein CCTCAAAATAAAGAATTGCATGATAACAACGNDND
Ω204115928255SA2462 icaC Intercellular adhesion protein CATAACTAAATAACGTTCTAAGAAATTTAATNDND
  • a Open reading frame numbering (ordered sequence tag) from the N315 genome.

  • b The first 30 nucleotides after the Em-Mu disruption site in the gene sequence are indicated.

  • c Transcription sense of Em-Mu cassette relative to the insertion site.

  • d Immunoreactivity to polysaccharide intercellular adhesion antigen was scored with polyclonal anti-PIA antibodies on whole-cell extracts. +, approximate wild-type expression level (≥80%); ++, above S30 wild-type expression level; ±, reduced expression; −, equivalent Ω 4681 icaA mutant expression level.

  • e Wall teichoic acid extraction, polyacrylamide gel resolution and staining: +, wild-type expression level; −, SA113 tagO mutant expression level.

  • f HP, hypothetical protein.