TABLE 1.

Primer sequences (5′ to 3′)

PrimerSequence
BBL39-LIC-FGACGACGACAAGATGCTTATAGGTGCTTGCAAG
BBL39-LIC-RGAGGAGAAGCCCGGTTTATTTTAAATTTCTTTT AAGCTC
BBN38-LIC-FGACGACGACAAGATGCTTATAGGTGCTTGCAAA ATTC
BBN38-LIC-RGAGGAGAAGCCCGGTTTATTTTAAATTTTTTTA AGCAC
BBN39-LIC-FGACGACGACAAGATCAAGAATTTTGCAACTGGT AAAG
BBN39-LIC-RGAGGAGAAGCCCGGTTTACTGACTGTCACTGAT GTATCC
BBO40-LIC-FGACGACGACAAGATTAAAAATTATGCAACTGGT AAAG
BBO40-LIC-RGAGGAGAAGCCCGGTTCAATATGAATTACTATC CTCAATG
BBP39-LIC-FGACGACGACAAGATTAAGAATTATGCAATTAAA GAT
BBP39-LIC-RGAGGAGAAGCCCGGTTTAATCTTCTTCATCATA ATTATCC
BBM38-LIC-FGACGACGACAAGATTTACGCAAGTGGTGAAGATG
BBM38-LIC-RGAGGAGAAGCCCGGTTTATTCTTTTTTATTAGA ATC
BBO39-LIC-FGACGACGACAAGATTTATGCAAGTGGTGAA
BBO39-LIC-RGAGGAGAAGCCCGGTTTATTCTTTTTTATCTTC TTC
BBR42-LIC-FGACGACGACAAGATTGATGTAACTAGTAAAGAT TTA
BBR42-LIC-RGAGGAGAAGCCCGGTCTTTATTCTTTTTTACCT TCTACA