TABLE 1.

Primers used in this study

OrientationPrimer sequencePurposeVectorProduct
ForwardCTTCACCGCAGCCTTGCTTAGLocate 5′ end of mRNANone
ForwardGTCTGCCAACGCTCGATTCACLocate 5′ end of mRNAPerfectly blunt675 bp
ForwardAACCTCACCTCGCTACTACLocate 5′ end of mRNA591 bp
ReverseGGCCGTTTCCCTTGATTCTCC3′ end of mRNAPerfectly blunt
ForwardGAATTC-ATGGCCTCTCTCAAAGCTGGAGACExpressionYEp-FLAG-1512 bp
ReverseGTCGACTTA-CAACTTGGAAATGACGGCGTCExpressionYep-FLAG-1