TABLE 3.

Primers used for real-time PCR in this study

PrimerNucleotide sequence (5′→3′)PrimerNucleotide sequence (5′→3′)Product size (bp)
ciaR-senseGAAGCAGAGAGTGGCGTTTATGciaR-antisenseTGTCATCCAAACCTTCCTTAGC145
comD-senseTATGGTCTGCTGCCTGTTGCcomD-antisenseTGCTACTGCCCATTACAATTCC97
comX-senseCGTCAGCAAGAAAGTCAGAAACcomX-antisenseATACCGCCACTTGACAAACAG89
comYA-senseATTATCTCTGAGGCATCGTCCGcomYA-antisenseACCATTGCCCCTGTAAGACTTG102
htrA-senseAAGTTGTTAGACCCGCTCTTGGhtrA-antisenseACCGCTTGTGACATCACTTGG101