TABLE 2.

Primers used for construction of deletion mutants in this studya

5′-end ampliconGene deleted3′-end amplicon
PrimerNucleotide sequence (5′→3′)PrimerNucleotide sequence (5′→3′)
ciaR-flanking-RVGCCAATGAGTCTCTTCCATGAciaRHciaH-BamHI-CCAAGGTATTGGATCCGAGGATAAGA
ciaR-BamHI-BTATTGACATGGATCCTGACATTCTCciaRHciaH-D2TTGCCAGAGACATTTGGAAAG
ciaH-ATCGAAATATCCCAAGTCATGCciaHciaH-BamHI-CCAAGGTATTGGATCCGAGGATAAGA
ciaH-BamHI-BTATTGACATGGATCCTGACATTCTCciaHciaH-D1TGAGAAAGACTTGCCAAATATGTTA
ciaR-flanking-RVGCCAATGAGTCTCTTCCATGAciaRciaR-BamHI-CTAGATAGACGGATCCCGTCTTCTAC
ciaR-BamHI-BAGTGTAGGAGGATCCTTGAAGGATciaRciaR-flanking-FWCCACCCTTTTGTCGTGTTCT
comED-A3GCAGGAGCTGGCTATCTTTTTcomEDcomED-BamHI-CAGTAAAATAGGATCCCCTGAGATGG
comED-BamHI-B3CCTTGTTGTGGATCCTCATCTTCCAcomEDcomED-DCCCCTTCCCCATTTTTAGTT
comD-ATTTTTGCGGTTAGCAAAATGcomDcomED-BamHI-CAGTAAAATAGGATCCCCTGAGATGG
comD-BamHI-BGAAAGTATCAGGATCCCTTCATTCAcomDcomED-DCCCCTTCCCCATTTTTAGTT
comED-A3GCAGGAGCTGGCTATCTTTTTcomEcomE-BamHI-CAGTAAAATAGGATCCCCTGAGATGG
comED-BamHI-B3CCTTGTTGTGGATCCTCATCTTCCAcomEcomE-DCCCCTTCCCCATTTTTAGTT
Comm55ACTTATCAGATGAGTTTGTCCATCcomCComm-BamHI-35TAGGATCCGCTAACATTGGAATAAAACAAG
Comm-BamHI-53AAGGATTCTGTTGATAGGCTTCCGCTTCCcomCComm-33TGCTGTCAAGGGTATCTTGTCAGC
  • a In addition, primers used for amplification of the putative promoter of comC were as follows: PcomC RI5′, AAGAATTCAAATGCTTGTGTATTCATATG; PcomC-Bm3′, ATGATAGTGTTTTTTTCATGGATCCTCTCC.