TABLE 2

Primers used in this study

PCR primerSequence (5′–3′)
ApiA-NdeI-FGGAATTCCATATGACATATCAATTATTTAA
ApiA-EcoRI-RCGGAATTCTTACCACTCAAAGTTTAAACCG
ApiA(Δ284-295)-EcoRI-RCGGAATTCTTAGCCACCATTGGTACTTACTG
ApiA(Δ186-217)-FATTGCAACCGACAAAGAAGTAAAAAAC
ApiA(Δ186-217)-RTTCTTTGTCGGTTGCAATCGCTCTGGA
ApiA(Δ186-240)-FATTGCAACCGGCAGCCTTAACTTGAGT
ApiA(Δ186-240)-RAAGGCTGCCGGTTGCAATCGCTCTGGA
ApiA(Δ28-185)-FGCTAAAGACTTTAGATCTTCAAGCCAA
ApiA(Δ28-185)-RAGATCTAAAGTCTTTAGCCAATGCATT
ApiA(Δ186-229)-FATTGCAACCGCACTAAGCGGCTTATTC
ApiA(Δ186-229)-RGCTTAGTGCGGTTGCAATCGCTCTGGA
Aae-C-terminal-FCGCGGATCCAAATTAGGCAGAACAAGTTTC
ApiA(Δ218-295)-BamHI-R-Aae-CterCGCGGATCCTAATTCATTGACTCGGCTATC
ApiA(Δ186-295)-BamHI-R-Aae-CterCGCGGATCCGGTTGCAATCGCTCTGGAAT
ApiA(Δ37-101;Δ218-295)-F-Aae-CterCCTTCTGCTGAGTTAGATATTCGGAAA
ApiA(Δ37-101;Δ218-295)-R-Aae-CterATCTAACTCAGCAGAAGGATTTTCCAG
ApiA(Δ46-90;Δ218-295)-F-Aae-CterAAAAACAGGCTTGTTAACAGGGCAAGG
ApiA(Δ46-90;Δ218-295)-R-Aae-CterGTTAACAAGCCTGTTTTTAAAGACTTG