TABLE 3

PCR primers to construct tagless CFA/I/II/IV-3×STaN12S-mnLTR192G/L211A chimeric genea

PrimerNucleotide sequence (5′ to 3′)
STaNcoI-FCATGCCATGGAAATGGCTAGCATGAATAGTAGC
LT30CFA-RTGCGCTAGCCATGTACTCATTATGCCCTCT
LT30CFA-FAATGAGTACATGGCTAGCGCAGTAGAGGAT
LT160CFA-RGTAACCATCGGCTCCCAAAGTCATTACAGG
LT160CFA-FACTTTGGGAGCCGATGGTTACAGATTAGCAGGTT
T7-RTGCTAGTTATTGGTCAGGGGT
  • a PCRs to fuse CFA/I/II/IV MEFA gene (from strain 9175) to 3×STaN12S-mnLTR192G/L211A gene (from strain 9331) by replacing nucleotides coding amino acids 31 to 159 of LT A1 peptide with the CFA/I/II/IV MEFA and also to remove nucleotides encoding the 6×His tag.