TABLE 4

Primers used for qRT-PCR

PrimerSequence (5′-3′)Function
cas9-up-FAATATGCCCAGCTTTCCTTCAn upstream fragment of the cas9 ORF
cas9-up-RACCCAACAGAAAGGCACATA
cas9-self-FCAATAGGCCTTGACATCGGA fragment of the cas9 ORF
cas9-self-RTTCAAGCGTCTATCTGCAGC
cas9-down-FGTTGGCGAACCGTTGTTGA downstream fragment of the cas9 ORF
cas9-down-RCCAAACGTTTAATCAGCATGG
regR-F(RT)TGATGTAGGCTGAATAATGAAAA fragment of the regR ORF
regR-R(RT)TATGATGCCAAAAGTGAAGA
hylB-FAACGCCAAAAACATCAAAGAA fragment of the hylB ORF
hylB-RTGAAGCCAAGCCAGACTCTC
MSP-FTGTCCCCATCAAAATAAGCAGA fragment of the minor structural protein ORF
MSP-RTACCACCAAATCCTACACCAT
DNA methylase-FGATAATCTCGTCCTCCGCCACA fragment of the DNA methylase ORF
DNA methylase-RTTTTACATTTGTTGACCTCCTCCAG
treP-FATTTCCTTCGCTCATCCCTTCA fragment of the treP ORF
treP-RTGCATTCTTTACACTGCACCAG
treC-FGCAATGTCTGCTGCTGAAGTACA fragment of the treC ORF
treC-RTGTGACTCGTAAGATGGGGACT
HK97-FCTGCCACTTTGTGAGCGTTTGA fragment of the HK97 ORF
HK97-RTGATTGGTTATTCGCCTATTGC
holin-FCTGCTGCCATGAGACCTGTGAA fragment of the holin ORF
holin-RAGGACTTATCGGATCAATCTTTGG
SNF2-FTTTTCTTTATCCGTCAGTCGCA fragment of the SNF2 ORF
SNF2-RGTAGGAATGGCAATGTCGTCT
clpP-FCGAGTAGTGGGAAGAAGAAAA fragment of the clpP ORF
clpP-RTCAGGTAAGAGCGGATAGAG
recF-FATCACGATGAGGTCCGATGCTA fragment of the recF ORF
recF-RTATCCAAGCCCTAAATGATGAAGC
apbE-FGTGGTCCAGATTTCACAGTCGA fragment of the apbE ORF
apbE-RCAGGTACTTATGAACGCCGTCT
16S rRNA-FCGACGATACATAGCCGACCTA fragment of 16S rRNA
16S rRNA-RCCGTCACTTGGTAGATTTTCC
IL-6-FCCACTTCACAAGTCGGAGGCTTAA fragment of IL-6 in mice
IL-6-RGCAAGTGCATCATCGTTGTTCATAC
TNF-α-FAAGCCTGTAGCCCACGTCGTAA fragment of TNF-α in mice
TNF-α-RGGCACCACTAGTTGGTTGTCTTTG
β-actin-FTGACAGGATGCAGAAGGAGAA fragment of β-actin in mice
β-actin-RGCTGGAAGGTGGACAGTGAG