TABLE 1

Bacterial strains and plasmids used in this study

Strain or plasmidDescriptionaPrimer sequencesb used to create strain, reference, or source
Strains
    MG1655::clmMG1655 with a chloramphenicol resistance cassette inserted at the attTn7 siteF: AGGATGTTTGATTAAAAACATAACAGGAAGAAAAATGCTGTGTAGGCTGGAGCTGCTTCG
R: ATCGGTTACGGTTGAGTAATAAATGGATGCCCTGCGTAAGCATATGAATATCCTCCTTAG
    F11E. coli cystitis isolate (O6:K2:H31)98
    F11::clmF11 with a chloramphenicol resistance cassette inserted at the attTn7 site32
    F11::kanF11 with a kanamycin resistance cassette inserted at the attTn7 siteF: TCTGGCGTAGCCTGGGAGTTATTGCCGGATGCGATGCTGGTGTGTAGGCTGGAGCTGCTTCG
R: TCACGTAAAAAAACGTCTAATCCGTAGACCGGATAAGAGGCATATGAATATCCTCCTTAG
    F11ΔclbCDEFG::clmF11 with the clbCDEFG operon replaced with chloramphenicol resistanceF1: TCGGGCGATCGATAGATTAG
R1: CGAAGCAGCTCCAGCCTACACAGCTTGCGTATTCCATAAACTTC
F2: TGTGTAGGCTGGAGCTGCTTCG
R2: CATATGAATATCCTCCTTAG
F3: CTAAGGAGGATATTCATATGCCCGTCACGCCATTTTACGT
R3: TAATATACGCCAGTTGCCGC
    F11Δcnf1::kanF11 with the cnf1 operon replaced with kanamycin resistanceF: GATAAGGTGTAGTAAAATATTAATCTTCACAGAGGAGTGTGTAGGCTGGAGCTGCTTCG
R: GGAGTAACTATAACAATGGCCAATAAATAATTTCCCGAACATATGAATATCCTCCTTAG
    F11ΔfimH::kanF11 with the fimH operon replaced with kanamycin resistanceF: TTATTGATAAACAAAAGTCACGCCAATAATCGATTGCATGTGTAGGCTGGAGCTGCTTCG
R: ATGAAACGAGTTATTACCCTGTTTGCTGTACTGCTGATGGCATATGAATATCCTCCTTAG
    F11ΔfimHΔfliC::clmF11 derivative in which the fimH gene has been deleted and the fliC gene has been replaced with a chloramphenicol resistance cassettefimH and fliC single-knockout primers
    F11ΔfliC::kanF11 derivative in which the fliC gene was replaced with a kanamycin resistance cassetteF: ATGGCACAAGTCATTAATACCAACAGCCTCTCGCTGATCTGTGTAGGCTGGAGCTGCTTCG
R: TTAACCCTGCAGCAGAGACAGAACCTGCTGCGGTACCTGGCATATGAATATCCTCCTTAG
    F11ΔhlyA::kanF11 derivative in which the hlyA gene has been replaced with a kanamycin resistance cassette99
    F11ΔpapG::kanF11 derivative in which the papG gene has been replaced with a kanamycin resistance cassetteF: ATGTTTTACTCGTTTAATGATAACATTTATCGTCCTCATGTGTAGGCTGGAGCTGCTTCG
R: TTATGGCAATATCATGAGCAGCGTTGCTGAACCAGATAGTCATATGAATATCCTCCTTAG
    F11Δusp::kanF11 derivative in which the usp gene has been replaced with a kanamycin resistance cassetteF: GTGGGCGATATTGTTTACCTGAGAATAATCGGTGAGAATGTGTAGGCTGGAGCTGCTTCG
R: TTATCTCCTGTAGTGAATCTCATCGTGTAGTCTGGGGGTACATATGAATATCCTCCTTAG
    F11::kanΔpUTI89Derivative of F11::kan which was cured of the pUTI89 plasmid by replacement of ccdAB with tetA-sacB followed by counterselectionF1: CTGTTCGTTTATTACGCCG
R1: GATAGAGTGTCAACAAAAATTAGGAATGTCAGGCTCCGTTATACAC
F2: TCCTAATTTTTGTTGACACTCTATC
R2: TTAATCAAAGGGAAAACTGTCCATATGC
F3: GCATATGGACAGTTTTCCCTTTGATTAAAGCACACCTCTTTTTGACATACT
R3: GTTGCTATTTCTGGCTTAGTCAG
Plasmids
    pHJ20Carries fimH under the control of the tac promoter100
    pHJ19Same as pHJ20 except that fimH is positioned in the opposite orientation101
    pfliC-luxCarries the luxCDABE gene cluster (encoding bacterial luciferase) transcriptionally fused with a conserved fliC promoter62
    pKM208Encodes IPTG-inducible lambda red recombinase93
    pKD3Template plasmid used to amplify the Clmr cassette94
    pKD4Template plasmid used to amplify the Kanr cassette94
    pCP20Flippase expression construct94
  • a IPTG, isopropyl-β-d-thiogalactopyranoside.

  • b F, forward primer; R, reverse primer. In some cases, longer homology arms were created by three-part PCR. In these instances, three primer sets are listed.