Table 1.

Primers used in this studya

PrimerSequence (5′-3′)GenePosition
PFTGTCTCTGTCACGCATTGTC prn 152–171
AFGCCAATGTCACGGTCCAA prn 649–666
ARGCAAGGTGATCGACAGGG prn 1234–1217
BRCGGATTCAGGCGCAACTC prn 2076–2059
BFAGCTGGGCGGTTCAAGGT prn 1542–1559
PRATGCCGTTGGTGTGTACCGT prn 2714–2695
S1FTAGGCACCATCAAAACGCAG s1 474–493
S1FM ACAATGCCGGCCGTATCCTC s1 946–965
S1RTCAATTACCGGAGTTGGGCG s1 1350–1330
  • a The gene harboring the target sequence (italicized) is indicated. A schematic representation of primer positions in the prn gene is depicted in Fig. 1. Primers were derived from published sequences of prn (8) and the S1 subunit (20, 24).