TABLE 1.

16S rRNA gene group-specific and kingdom-specific primers for qPCRa

GroupReference strainPrimerSequence (5′ to 3′)Temp for last step (°C)Reference
Eubacteria (all bacteria)Ruminococcus productusUniF340ACTCCTACGGGAGGCAGCAGT631
    ATCC 27340DUniR514ATTACCGCGGCTGCTGGC63
Eubacterium rectale/Ruminococcus productusUniF338ACTCCTACGGGAGGCAGC6012
    Clostridium coccoides    ATCC 27340DC.cocR491GCTTCTTAGTCAGGTACCGTCAT60
Lactobacillus/LactococcusLactobacillus acidophilusLabF362AGCAGTAGGGAATCTTCCA5627
    ATCC 4357DLabR677CACCGCTACACATGGAG56
BacteroidesBacteroides fragilisBactF285GGTTCTGAGAGGAGGTCCC6110
    ATCC 25285DUniR338GCTGCCTCCCGTAGGAGT61
Mouse intestinal BacteroidesMIB plasmid CT11-6Uni516FCCAGCAGCCGCGGTAATA5829
MIBR677CGCATTCCGCATACTTCTC58
Segmented filamentous bacteriaSFB plasmid CTL5-6SFB736FGACGCTGAGGCATGAGAGCAT5830
SFB844RGACGGCACGGATTGTTATTCA58
Salmonella enterica serovarATCC 700720-DSal454TGTTGTGGTTAATAACCGCA5617
    TyphimuriumUni785RGACTACCAGGGTATCTAATCC56
EnterobacteriaceaeEscherichia coli ATCCUni515FGTGCCAGCMGCCGCGGTAA6716
    10798DEnt826RGCCTCAAGGGCACAACCTCCAAG67
Clostridium perfringensClostridium perfringensCperf165FCGCATAACGTTGAAAGATGG6134
    ATCC 13124D-5Cperf269RCCTTGGTAGGCCGTTACCC61
HelicobacterHelicobacter pyloriHp 547FCTTAACCATAGAACTGCATTTGAAACTAC5732
    ATCC 700392D-5Hp 665RGGTCGCCTTCGCAATGAGTA57
  • a Primer sets for qPCR were designed based on published probes specific for the different bacterial groups in combination with a universal primer. Groups were defined in ARB software (18) based on the published probe in combination with a suitable universal primer or a pair of published primers. The compatibility of primer combinations for qPCR was tested by Primer Designer 5 (Sci Ed Programs). The primer sets were tested for sensitivity and specificity against a wide panel of bacterial genomic DNAs and showed minimal cross-reactivity.