TABLE 1.

Primers used for omp transcriptional analysis and sequencing

GenePrimeraSequence (5′-3′)Amplicon size (nt)bGenePrimeraSequence (5′-3′)Amplicon size (nt)b
omp1RT/S FAAGTACGAGTCTGATACCGCACTCAAAC778S RAACAACAATAGAGCGCTACG
RT/S RAAAACAGCAGGGTGGCACCGQ FTGCCCGAGCACCGAGATTTCTTAT
Q FCAGAAATTCCCCGTAGATACCAAQ RATGACAGGGTACCTTTCTGCACCA
Q RTGGTCACTTCCTTATTCTCAGCGProbeACTGGAAGATGCGCTGCTTACCGCGA
ProbeTTGCTACAAGGCCGCAGGAGCComp9RT FAGCTGGGGCTCTTGCGTTTG
omp2RT FGATTGAGTCTATGGGGGAACAAAAGAG567RT RAACATATTCACTATAATCTGACGCTGC1,096
RT RGAGCTTCGAATGGTGCAGAGAGS FAGCGTCTACTGATTGTGTTC1,186
S FAATCAGGTTCGGATTCTAGG1,102S RTTCACTATAATCTGACGCTG
S RCAGTGAGTCTTCACATGGAGQ FGAAGTCACTACACGACCTGACTGT
omp3RT FGTGCCTCATTCGTACCTCCTACC314Q RTAAAGCATCTTCGCGGGTCGT
RT RGGGGTAAGTAGAGAGGCACTGATGProbeTATTCAGTGCGCTGAACACTGCGATCCA
S FTCTCCAAATTCCCGGTGCCT675omp10RT FTCCTTCGGGTTGCTGCGTTG969
S RGGTGGGTGTCCTAGAATCCGRT RGCTTACCCCCATTCCAGCAC
omp4RTFTTGAGAAACTTGCTCCAATGTTAAAACC922S FCACATTTTGGTTGCATTTATCG1,146
RTRAGCGGAATTGGCACTGTGCS RATTCGCAGTTCTATGCAGCA
S FAATTTTTGTGGTTGGCGGTG1,294QFTGGAAGAAGGTAAGAGGCTTGGCA
S RCACTCTGCCAACTAAAATAAAAGGAQRTCGCCGACCCAACATAGTTAAGCA
QFAGCTGGGCATAGGAAGAGAAGCATProbeAAGGCAGAAGCAGAAGCGCGAAGAT
QRTGTGTCACCTCCTGTGTGTTGGAAomp11RT FATGAGCTTTGTAAGGTTTCTTGCC624
ProbeTGCACGCGCAAGATTTCGGATAAGCART RAAGCACCGAGGAGAGCTGTACC
omp5RT FAACTCGAGCTTCAGCCCCAG868S FCTACGGGAGTAAATACTTGG1,145
RT RTGCCCTTGAGCCACACTCACS RTACCACATACACGGCAAAAC
S FAAGCGTGCGTAGCTAAAACT1,177QFGTGCTTGCTAGTTTGTGCAGGGAT
S RTGAAGCTGGTAGAATCCCGGQRCAATCTTCGCCTGGTAAGAAACCC
omp6RT FCTCCAATCGGAGGGGTTGTG492ProbeTGCCATATGTGTGTGCTGGGTTTGGT
RT RGCATAAATCCAGTTTAGCCTCComp12RT FATGGGATCTATGATGAGGGC703
S FCATCGTGAATATACTGAGGA694RT RCAATAAATAGCGTCACACCCC
S RAAACATGGATCACAGACGTTS FTGTGAGAGTTGCCGCTTCCG959
omp7RT FGTGGTTAGATCTTTTCTGTTGGG399S RTGCGGTGAGCACGTAGCAAA
RT RCGCTCTACCACTGACCTTCATGomp13RT FATGGTTAAAGCAGGGGCAGCATG474
S FTGGGGAGGGGATGTGTGTTG1,105RT RGCTCCTCGCAACCTTAAATTCC
S RCGCGGCACTGCTCTTTATACS FCGTTTTACAACCTTGACTTT1,156
Q FTTCGTGCGCTGTCCTCTTCTACTCS RGAAAATACGCGCATACACAC
Q RTGTCCGTGCACCAATCTCACTAGAomp14RT FGAATCCGAACCTGATTCCTAGTTCT690
ProbeAGTTGCATAATCTTGCGGATGCGCTART RACAAGGAGTTGTCCAAGCCGG
omp8RT FAACTGGTAGGCTGGAGTTCG213S FTAGTGCCGGGAACCGCAAGT1,155
RT RAGTGATAAGAAATCTCGGTGCTCS RGGGATGAACGGTCGTGAAGA
S FAGTGAATATGTTGAGAGGGA1,374
  • a RT, forward (F) and reverse (R) primers used for detection of transcript after reverse transcription; S, forward (F) and reverse (R) primers used to amplify open reading frames for cloning and sequencing; Q, forward (F) and reverse (R) primers used for quantitative PCR; Probe, TaqMan probes used for quantitative PCR.

  • b nt, nucleotides.