TABLE 2

Primers used in this study

Primer nameSequencea
bspC.F1GCTCTAGAGCAATTAGCAGATGCACAG
bspC.R1TAAAATCAAAGGAGAAAATATGAACTTTA
bspC.F2GCTTTTATAATCAATATTCAGAAGCACTTG
bspC.R2CGGGATCCGAGCCAAATTACCCCTCC
cat.FAGAAAATATGAACTTTAATAAAATTGATTTAG
cat.RTGAATATTGATTATAAAAGCCAGTCATTAGG
pMSP.bspC.FCATGCCATGGAGGAGGAAATATGTATAAAAATCAAAAC
pMSP.bspC.RCCGCTCGAGGCAGGTCCAGCTTCAAATC
  • a Restriction endonuclease sites are underlined.