TABLE 3.

qRT-PCR analysis of gene expressiona

Schu4 ORF no.Putative functionFold differencebqRT-PCR primer pair (5′-3′)d
MicroarrayqRT-PCR
26cHypothetical protein (FigD)14.813.4F: AAGCCTAATGGTAGCTGGTGAATC
R: TTTTGGTGAGACTCCGTAAGTTTTT
29cHypothetical protein (FigA)19.724.7F: GGCTACTAAAGACAAAACACTAATGCC
R: CAGACTCAGGCGATACTGTTCTTG
27cDiaminopimelate decarboxylase (FigC)15.113.0F: GGTTTAGCAGGAATAAGCCCTACTC
R: TTGTCGCGGCATATAGTTCTAAATC
28cHypothetical protein (FigB)9.919.1F: GAGTTTTTTAGCTCAGACCCGATAATC
R: ATCGGCGCTGAAAATAGCA
651cProton-dependent oligopeptide family protein2.40.6F: CTCGCAAAAAAGACATTAGTATAAAATTAAAT
R: AAGTTGCAAATTGTCCCCAAA
1712cIntracellular growth locus, subunit c (IglC)3.02.6F: AAAAAGGAGAATGATTATGAGTGAGATG
R: TGCAGTAGGATCAGTTCTCACATG
403Peptide deformylase2.83.2F: CAGCTATAATATTTCAGCATGAATTTAATCA
R: AGCAAATTTAGCTTGTAGTTCTTCGTT
1699Conserved hypothetical protein (PdpA)2.62.6F: TGAGTTAATTTCAAACTCTGCCATATC
R: GTTTGGGTATATGCCATTTCACAG
1780Putative transposase1.51.1F: AAGAACCGGAGATTATAGTTCAAAGC
R: AAATACTGTTCAATCAATGTTTTATCGG
651cProton-dependent oligopeptide family protein1.30.7F: CGTTGATAGTAAAACTATTGGTTTTGCA
R: GGAAGAGCAACCACTTGATTTAATAGA
664cHistidine decarboxylase1.01.1F: CATTTGATGGTGCTTTTCTACCG
R: ATATTCCTGAAGGCATCGGATTAC
583Outer membrane-associated protein0.91.0F: CAAATCTAGCAGGTCAAGCAACAG
R: AACACTTGCTTGAACATTTCTAGATAGTTC
700Conserved hypothetical protein0.80.6F: AAAATGGTGTTCGCCTTTTGG
R: CCTTCGACATCATCTTTGTAGTCAAC
445ABC transporter, ATP-binding, pseudogene0.91.2F: TTAGAAGAGTTTGTTGGAGGATATGATG
R: ATTTTTCGACAACTCACTGTTATTTTTAGT
881cAmino acid permease0.40.6F: CCAAGGTTCAGAAATTATCGGACTA
R: GTGCTTAGCGATTCTTGGCAT
50Translation initiation factor IF20.60.8F: TTGGCGCGTATTCTGTTAAGAC
R: GCTCGCATTGAAGTAAAAGCCT
14050S ribosomal protein L110.50.8F: ACGCCACCTGCTTCTTACTTAATT
R: CGCACGAGTTATAGTTCCAACAA
350DNA-directed RNA polymerase, alpha subunit0.70.7F: TTGACAAACCAAAGAGCATTTAGC
R: TCTCAAGCTCGGTTGGTATCG
1695Chaperone protein, GroES0.40.5F: GCTCAAGAGAAACCTAGCCAAGG
R: ACATCCATAGGTAGCGTAGTGCC
32650S ribosomal protein L40.50.7F: AGTTTCTGGTGGCGGTGC
R: GGTGAACGGATAGTACCCGCT
1696Chaperone protein, GroEL0.40.7F: TTCAAAGACAGCGGATGTTGC
R: GCGACAGCTTTTAGACCCTCTG
  • a qRT-PCR for each gene was performed with two individually prepared RNA samples, each in triplicate.

  • b The fold difference indicates the gene expression level under iron-restricted conditions relative to that obtained under iron-replete conditions.

  • c ORF 651 in the F. tularensis Schu4 genome was found to be fragmented into two separate ORFs in the F. tularensis LVS genome by the deletion of a single nucleotide.

  • d F, forward; R, reverse.