TABLE 2.

Oligonucleotides used in this study

OligonucleotideSequence (5′ → 3′)aDescription
tmRNA tag GGCCGC A ACTAGT TGCAGCAAACGACGAAAACTACGCACTAGCAGCTTAATAACAGAGCTCoding strand of tmRNA tag
tmRNA tag C TGTTATTAAGCTGCTAGTGCGTAGTTTTCGTCGTTTGCTGCAACTAGTTGCNoncoding strand of tmRNA tag
tapA-1ATTGCACTTCCTGCATATCAGACCUsed to amplify internal fragment for knockout
tapA-2CGGGACCAGTATATATGTGTATGCUsed to amplify internal fragment for knockout
tapA-3 AGGAGAATTCACATGAAGAAGCAATCAGGCUsed for RT-PCR of tap mRNA and to clone complete tapA gene
tapA-4 TATTGGATCCAGAGGTCATGCGTTAGCAGUsed for RT-PCR of tap mRNA and to clone complete tapA gene
flpA-1CGGCCTTGCATGCCAGCAAGGTTGCGUsed to amplify 5′ flanking region of flpA for knockout
flpA-2 CCAAGATCTGAGCGCTGTCACTTGCCCGCGGCUsed to amplify 5′ flanking region of flpA for knockout and to clone complete flp-1 gene
flpA-3 GCGAGATCTCTGACCACTCCTCTATTTATGTAGTCUsed to amplify 3′ flanking region for knockout
flpA-4GCTTGCTGGTGAGGATCACATCCACCCUsed to amplify 3′ flanking region for knockout
flpA-FCATATTGATGGCGTGCTGGTUsed for RT-PCR of flp mRNA
flpA-RCACAAAATGGCGAATCCATAUsed for RT-PCR of flp mRNA
flpA-5 GGACGAATTCATGAAGATGCGAGTTTGGGUsed to clone complete flp-1 gene
MMB01CATCATAACGGTTCTGGCUsed to sequence or amplify insert of pMMB plasmids
MMB02GAAAATCTTCTCTCATCCGCUsed to sequence or amplify insert of pMMB plasmids
  • a Restriction sites are underlined, and non-sequence-specific regions are indicated by bold type.