TABLE 1.

Primers used for amplification of recombinant proteins

ProteinForward primer (5′→3′)Reverse primer (5′→3′)
OMP2CGGATCCACATGTCCAAACTCCAAGCTTGGATACACGTGGGT
Cpn 0980ATGCTTAATCATGCTAAAAAGCTCTTTTATTTTAGGAAGCTT
Cpn 0809GGGAATTCGTCTATTTCATCTTCGGGAATTCTGATTGCGGCATACG
PMP 8NAGCATTGCAACTTACGGAGCAGCTGTGTTCCCGCATCTAT