TABLE 3.

Primer pairs used in RT-PCR studies

LocusPrimerPrimer sequence (5′-3′)
fspA1RT-01AAAACGCTTTAGCGCAAGAT
RT-02TTGTTGCGTGTTGTTTTGTG
fspA2RT-03TGTTCATAGCGACAATGTGGT
RT-04AAGCCTCTAATGCGGGATTT
flaART-05TCGTATTAACACCAATGTTGCAG
RT-06GCTTGAGATCTTAAACTATCTGCTATC
ilvCRT-07AAAAAGTAGCAATTATAGGCTTTGG
RT-08TTGCTTTAACAGCACTTACACTACC
Cj0977RT-09ACCACAAGCGAAATGGTAGC
RT-10TCGTCAAAAAGTGCATGAGC
23S RNART-11GGTAGGAGAGCGTTCTATTTGC
RT-12CGACTTAGGACCCGACTAACC
16S RNART-13GGGAAAGTTTTTCGGTGTAGG
RT-14GTTGCTGCGTCAGGGTTT