TABLE 2.

Primers used in this study

PrimerSequence (5′-3′)aLocationb or reference
arlRprobe+CAATGTGGACACAGAGTATG1465970-1465989
arlRprobe−CAGTTCGTGGCGTTGGG1465422-1465438
arlSprobe+CAGCAGTATTAGAAGAATCG1464595-1464614
arlSprobe−GAGTCCATTACCGCCTTGAC1464154-1464173
Asp23probe+ATGACTGTAGATAACAATAAAGC 11
Asp23probe−TTGTAAACCTTGTCTTTCTTGG 11
capAp-FcgcaagcttCAAACATCATATGATTATAAGC153034-153055
capAp-RgcgccatggTTTACCTCCCTTAAAAATT153384-153402
oSTM01taggtaccTCAAAAGAAGTTAAACAAAG548665-548684
oSTM02cggatccATATTAATCGAAAATTATAATTCC549175-549198
oSTM03cgcctgcagATTATGATGATATGAAAATTATTG549706-549729
oSTM04gcgaagcttGACCAATAACAACATCTTCGCC550760-550781
oSTM20GAAAATCATTAACACAACAAG548806-548826
oSTM21CTTAATTTTACTTACTAATTC549155-549175
oSTM28cgatggatccGTGTTATGAATTTAATGAATGAG548603-548625
oSTM29gcgtcgacTTATTGCAAATGTATTACATCGC549574-549596
oSTM30CTAAATAAAACAGAGAGATATATACTATAGG549213-549243
oSTM31gcgggtaccGTGTTATGAATTTAATGAATGAG548603-548625
oSTM32gcgggatccGAAGCTTGATTAAACATATTAATCG549189-549213
oSTM33gcgggatccTTATTGCAAATGTATTACATCGC549574-549596
oSTM34ggattttcatatgACTAAAACTCCTTTTATGAAAAC548778-548800
oSTM61cgcggatccCAAACATCATATGATTATAAGC153034-153055
oSTM62gcgctcgagTTTACCTCCCTTAAAAATT153384-153402
oSTM63cgcggatccGCAGTAAACCTAAAGTGTCG1466817-1466836
oSTM64gcgctcgagTTGTACACCTCATATTACGAC1466067-1466087
oSTM71gtgcatatgAAAGTGACAGATGTAAGACTTAG549259-549281
  • a Lowercase letters represent nucleotide additions.

  • b Based on the sequence of strain COL (RefSeq accession no. NC_002951 ).