TABLE 1.

Oligonucleotides used for real-time RT-PCR

GenePrimer (5′-3′)
ForwardReverse
lerCGACCAGGTCTGCCCTTCTGCGCGGAACTCATCGAAA
escCGCGTAAACTGGTCCGGTACGTTGCGGTAGAGCTATTAAAGGCAAT
escVTCGCCCCGTCCATTGACGCTCCCGAGTGCAAAA
espATCAGAATCGCAGCCTGAAAACGAAGGATGAGGTGGTTAAGCT
eaeGCTGGCCTTGGTTTGATCAGCGGAGATGACTTCAGCACTT
rpoAGCGCTCATCTTCTTCCGAATCGCGGTCGTGGTTATGTG